Skip to main content

Advertisement

Table 3 Primers used in this work

From: Assessment of three Resistance-Nodulation-Cell Division drug efflux transporters of Burkholderia cenocepaciain intrinsic antibiotic resistance

Primer Sequence (5'-3') Restriction enzymea,b
KO1XLc GCTCTAGACTCGATGCCGCGCTGCTGGA XbaI
KO1BLc TTGGATCCGCGGTTCCGACTATCGCAAG BamHI
KO1BRc TTGGATCCCAGGCACGCTACCGCAG BamHI
KO1KRc GGGGTACCATCTGCGTCTCTTCCTTG KpnI
OP13LXd GCTCTAGAGGCGGCACACCGTCGAAC XbaI
OP13LBd TTCGGGATCCCATCTGGCCGCCGTTTAT BamHI
OP13RBd TTCGGGATCCTAATCGGCGATGTGTTGC BamHI
OP13REd TGGAATTCGCCACCCCCGCTCTCCCTTG EcoRI
KO4XLe GCTCTAGACCGTGATCCTGAACATCGTG XbaI
KO4NLe TTCATATGCGCAGACGGATCTGTACG NdeI
KO4NRe TTCATATGCTGCGCGACGAGGAATGC NdeI
KO4KRe GGGGTACCCTGCTGGTAACAATCTGTAA KpnI
KO1F GAGGTCCAGCACGATGATG N/A
KO1R CGAGCATGTCCGTGACCAGT N/A
CO13OPL TCAAAGGGGTGTGGGCGGG N/A
CO13OPR GATTAAGGGAATTTCTTCTTGC N/A
KO4F GTCGCCGCACTTCTTCTC N/A
KO4R TCCTTGGTACGTCTGACC N/A
  1. a Restriction endonuclease sites incorporated in the oligonucleotide sequences are underlined.
  2. b N/A indicates the absence of restriction site.
  3. c The PCR cycling conditions used with these primers were: 95°C for 5 min followed by 30 cycles of 94°C for 15 s, 62°C or 52°C for 1 min respectively, and 72°C for 1 min, with a final extension at 72°C for 10 min.
  4. d The PCR cycling conditions used with these primers were: 95°C for 15 min followed by 25 cycles of 94°C for 1 min, 52°C for 1 min, and 72°C for 1 min, with a final extension at 72°C for 10 min.
  5. e The PCR cycling conditions used with these primers were: 95°C for 5 min followed by 30 cycles of 94°C for 15 s, 54°C for 1 min, and 72°C for 1 min, with a final extension at 72°C for 10 min.