Skip to main content

Advertisement

Table 4 PCR and qRT-PCR primers used in this study.

From: High-level chromate resistance in Arthrobactersp. strain FB24 requires previously uncharacterized accessory genes

Primer Sequence (5'→3') Description
C42/F CCCAAAGCTTGGGTCCTGCTCATCACCAGAAACTCCA HindIII site, used to construct pKH11
CF2/R GCTCTAGAGCAACCGCTTTCAGGCACTGTTGTTC XbaI site, used to construct pKH11
Primers for RT-PCR--asterisk denotes primer for cDNA synthesis
Primer Sequence (5'→3') Gene
MQO RT/A* AGGCCTGCCCGTAGACTTTC Arth_4255
MQO RT/B TCTTCACCGCCGGTATGAG Arth_4255
ChrB RT/A* CGAGGATGAGGGATCGTTTG Arth_4254
ChrB RT/B TGATCCGCAGGAACATCG Arth_4254
SP RT/F CCCGGGAGCACTTCGACTGGA Arth_4253
SP RT/R* CCTGGCGCGTTCGGTTGCAT Arth_4253
Cog4RT/F AAGGCCTACGTCTCCAACGAACA Arth_4252
Cog4RT/R* ATTCTGTCGGTGACCGTGTCAGT Arth_4252
ChrAP RT/A GCTTCATCCTGTGCTTCTTG Arth_4251
ChrAP RT/B* TGTTCATGATGCCGGTACTG Arth_4251
BP RT/F CCTGCGCCGCTACGAACTCACCGAT Arth_4249
BP RT/R* GCGCTGGTGTTCGTACAGCCCGTC' Arth_4249
ChrAC RT/A* AAGTACAGGGCCAGGTTC Arth_4248
ChrAC RT/B TGCGGTCCTGTCCTATATC' Arth_4248
Lppy RT/F AGTGACCACGGCCATCAATTTCCA Arth_4247
Lppy RT/R* TCAGGGAATGATTGTGCACGGAGA Arth_4247