Skip to main content

Table 3 Primers used in this study

From: 2D proteome analysis initiates new Insights on the SalmonellaTyphimurium LuxS protein

Primer Sequencea Purposeb
PRO-194 AAATCGATAGGTCGACGGGCCCGGTACC FW CMPG5702
PRO-195 AAATCGATCGCTGCCGCAAGCACTCAGG RV CMPG5702
PRO-196 AAGAGCTCCATGTACTACCTGCCGTATGCG FW pCMPG5700
PRO-197 AAGAGCTCACGTATCCTGATTCAGCGGG RV pCMPG5700
PRO-510 GCCGCACCGGCTTTTTCATGAGCCTGATTGG FW Y88→F88
PRO-511 CCAATCAGGCTCATGAAAAAGCCGGTGCGGC RV Y88→F88
PRO-512 GCCGCACCGGCTTTGACATGAGCCTGATTGG FW Y88→D88
PRO-513 CCAATCAGGCTCATGTCAAAGCCGGTGCGGC RV Y88→D88
PRO-514 GGAGCTGAACGTTTTCCAGTGCGGTACG FW Y126→F126
PRO-515 CGTACCGCACTGGAAAACGTTCAGCTCC RV Y126→F126
PRO-516 GGAGCTGAACGTTGACCAGTGCGGTACG FW Y126→D126
PRO-517 CGTACCGCACTGGTCAACGTTCAGCTCC RV Y126→D126
PRO-518 CCAGTGCGGTACGTTTCAGATGCACTCGC FW Y131→F131
PRO-519 GCGAGTGCATCTGAAACGTACCGGACTGG RV Y131→F131
PRO-520 CCAGTGCGGTACGGATCAGATGCACTCGC FW Y131→D131
PRO-521 GCGAGTGCATCTGATCCGTACCGGACTGG RV Y131→D131
PRO-0177 TTGCACTTCCTTTCATTTGCTGTGGCCAGTTTGCGGGAAGACTTTCACCTGTGTAGGCTGGAGCTGCTTC FW CMPG5726
PRO-0178 CATTATAGGATTACATCTGTTTATTATTGCCTGATCCGGAGTGAGTCTTTCATATGAATATCCTCCTTA RV CMPG5726
PRO-1428 AGCTGGCGCTGCCGAAAGAAAAACTGCAGGAACTGCATATTCTGTCTCTTATACACATCTCA FW CMPG5729
PRO-1429 TAAACCGGGGTTAATTTAAATACTGGAACCGCTTACAAATAAGAGTCTCTTATACACATCTGGT RV CMPG5729
PRO-0889 CTCGCCGATGGGCGCCCGCACCGGCTTTTAC FW C83→A83
PRO-0890 GTAAAAGCCGGTGCGGGCGCCCATCGGCGAG RV C83→A83
PRO-208 ATGAATTCGCGGCACCGGGAAAGCGTTCGG FW luxSphoA fusion
PRO-0415 GTTTCCAAGCTTATATGCAGTTCCTGCA RV luxSphoA fusion
PRO-0719 GAAGGGTCTAGATGAAACAAAGCACTA FW PhoA with signal peptide
PRO-1273 ATTCTAGACATGGAGAAAATAAAATGCCTGTTCTGGAAAACCG FW PhoA without signal peptide, contains ribosome binding site
PRO-0721 ATCTGCAGTTATTTCAGCCCCAGAG RV PhoA control plasmids
PRO-0238 GCTGGCGCTGCCGAAAGAAAAACTGCAGGAACTGCATATTGACTACAAAGACCATGACGG FW CMPG5649
PRO-0239 CCGGGGTTAATTTAAATACTGGAACCGCTTACAAATAAGACCATATGAATATCCTCCTTAG RV CMPG5649
  1. a Point mutations are indicated in bold
  2. b FW: Forward primer; RV: Reverse primer