malT knockout mutation invokes a stringent type gene-expression profile in Actinobacillus pleuropneumoniae in bronchoalveolar fluid

Table 7 Bacterial strains, plasmids and primers used in the construction of the lamB mutant

Bacterial strains, plasmids or primers*	Characteristic or sequence	Source or Remark
E. coli DH5α-pTOPOFL	DH5α harboring pCR4-TOPO containing lamB of A. pleuropneumia e CM5	This work
E. coli DH5α-TOPOΔFLcat	DH5a harboring pCR4-TOPO containing ΔlamB::cat	This work
E. coli DH5Δ-pEMOC2-ΔlamB	DH5Δharboring pEMOC2 containing ΔlamB::cat	This work
A. pleuropneumoniae CM5 ΔlamB	LamB negative mutant of A. pleuropneumoniae CM5	This work
pTOPOFL	pCR4-TOPO containing lamB of A. pleuropneumiae CM5	This work
TOPOΔFLcat	pCR4-TOPO containing ΔlamB::cat	This work
pEMOC2-ΔlamB	pEMOC2 containing ΔlamB::cat	This work
CrosslamB-L CrosslamB-R	GGTGGCGTAAAAGTAGGAGAT TGGTCATTATCCACCACCAA	Primers for the PCR amplification of the lamB gene of A. pleuropneumoniae CM5
stopuplamB-L	TTAGTTAGTTACAATATTTTCAACCCCTGCAC	Primers for the PCR generation of a linearized plasmid containing a deletion of 400 bp in the lamB gene cloned in pTOPOPCR-lamB
stopuplamB-R	TAACTAACTAATCACGCACAAGGTTC AAAAG
PstcrosslamB-L NotcrosslamB-R	TCATCTGCAGGGTGGCGTAAAAGTAGGAGAT ACAATACAGCGGCCGCTGGTCATTATCCACCACCAA	Primer sequences for the PCR amplication of the ΔlamB::cat and the insertion of the PsT I and Not I sites into the PCR product

* The genotype and the source of E. coli DH5α and the pEMOC2 and pCR4-TOPO plasmids are given in Table 6.

ISSN: 1471-2180