Skip to main content

Table 7 Bacterial strains, plasmids and primers used in the construction of the lamB mutant

From: malT knockout mutation invokes a stringent type gene-expression profile in Actinobacillus pleuropneumoniae in bronchoalveolar fluid

Bacterial strains, plasmids or primers* Characteristic or sequence Source or Remark
E. coli DH5α-pTOPOFL DH5α harboring pCR4-TOPO containing lamB of A. pleuropneumia e CM5 This work
E. coli DH5α-TOPOΔFLcat DH5a harboring pCR4-TOPO containing ΔlamB::cat This work
E. coli DH5Δ-pEMOC2-ΔlamB DH5Δharboring pEMOC2 containing ΔlamB::cat This work
A. pleuropneumoniae CM5 ΔlamB LamB negative mutant of A. pleuropneumoniae CM5 This work
pTOPOFL pCR4-TOPO containing lamB of A. pleuropneumiae CM5 This work
TOPOΔFLcat pCR4-TOPO containing ΔlamB::cat This work
pEMOC2-ΔlamB pEMOC2 containing ΔlamB::cat This work
CrosslamB-L
CrosslamB-R
GGTGGCGTAAAAGTAGGAGAT
TGGTCATTATCCACCACCAA
Primers for the PCR amplification of the lamB gene of A. pleuropneumoniae CM5
stopuplamB-L TTAGTTAGTTACAATATTTTCAACCCCTGCAC Primers for the PCR generation of a linearized plasmid containing a deletion of 400 bp in the lamB gene cloned in pTOPOPCR-lamB
stopuplamB-R TAACTAACTAATCACGCACAAGGTTC
AAAAG
 
PstcrosslamB-L
NotcrosslamB-R
TCATCTGCAGGGTGGCGTAAAAGTAGGAGAT
ACAATACAGCGGCCGCTGGTCATTATCCACCACCAA
Primer sequences for the PCR amplication of the ΔlamB::cat and the insertion of the PsT I and Not I sites into the PCR product
  1. * The genotype and the source of E. coli DH5α and the pEMOC2 and pCR4-TOPO plasmids are given in Table 6.