Bacterial strains, plasmids or primers | Characteristic or sequence | Source or Remark |
---|---|---|
E. coli DH5a | F-φ80lac ZΔM15Δ(lac ZYA-rg F)U169 deo R rec A1 end A1 hsd R17(rk -, mk +) sup E44 thi-1 gyr A96 rel A1 λ- | Clonetech |
E. coli β2155 | thr B1004pro thi hsdS lacZΔ M15 (F'lacZΔM15lacIq traD 36 proA+ proB+) Δdap::erm(Ermr)recA::RP4-2-tet(Tcr)Mu- km(Kmr)λpir | Reference no. 28 |
E. coli DH5α-pTOPOPCR-malT | DH5α harboring pCR4-TOPO containing malT of A. pleuropneumiae CM5 | This work |
E. coli DH5α- pTopoMC | DH5a harboring pCR4-TOPO containing ΔmalT::cat | This work |
E. coli DH5α-pEMOC2M | DH5a harboring pEMOC2 containing ΔmalT::cat | This work |
A. pleuropneumoniae | MalT negative mutant of A. | This work |
CM5 3ΔmalT | pleuropneumonaie CM5 |  |
pCR4-TOPO | A linearized plasmid for cloning PCR product | Invitrogen |
pEMOC2 | A conjugation vector based on pBluesript SK with mob RP4 and Cmr | Reference no. 31 |
pTOPOPCR-malT | pCR4-TOPO containing malT of A. pleuropneumiae CM5 | This work |
pTopoMC | pCR4-TOPO containing ΔmalT::cat | This work |
pEMOC2M | harboring pEMOC2 containing ΔmalT::cat | This work |
malT-L malT-R | ATGCAAGCAACATTTTCAAGA TTAGCTATACCCCATCATTCTCAA | Primers for amplification of the malT gene of A pleuropneumoniae CM5 |
stopupmalT-L | TTAGTTAGTTACGAGCTTTTTCACACCGTTT | Primers for generation of a linearized plasmid containing a deletion of 900 bp in its malT gene cloned in pTOPOPCR-malT. |
stopupmalT-R | TAACTAACTAATGGGAATGGCATCATTTAGA | Â |
pnmalT-L | TCATCTGCAGATGCAAGCAACATTTTCAAGA | Primers for amplication of the ΔmalT::cat and the insertion of the Pst I and Not I sites into the PCR product. |
pnmalT-R | ACAATACAGCGGCCGCTTAGCTATACCCCATCATTCTCAA | Â |
cat-L | CGGTGCCCTGAATGAACT | Primers for the PCR |
cat-R | AAGCTTCGACGAATTTCTGC | amplification of omlA-P driven cat gene of pEMOC2 |