Skip to main content

Table 6 Bacterial strains, plasmids and primers used in the construction of the malT mutant

From: malT knockout mutation invokes a stringent type gene-expression profile in Actinobacillus pleuropneumoniae in bronchoalveolar fluid

Bacterial strains, plasmids or primers Characteristic or sequence Source or Remark
E. coli DH5a F-φ80lac ZΔM15Δ(lac ZYA-rg F)U169 deo R rec A1 end A1 hsd R17(rk -, mk +) sup E44 thi-1 gyr A96 rel A1 λ- Clonetech
E. coli β2155 thr B1004pro thi hsdS lacZΔ M15 (F'lacZΔM15lacIq traD 36 proA+ proB+) Δdap::erm(Ermr)recA::RP4-2-tet(Tcr)Mu- km(Kmr)λpir Reference no. 28
E. coli DH5α-pTOPOPCR-malT DH5α harboring pCR4-TOPO containing malT of A. pleuropneumiae CM5 This work
E. coli DH5α- pTopoMC DH5a harboring pCR4-TOPO containing ΔmalT::cat This work
E. coli DH5α-pEMOC2M DH5a harboring pEMOC2 containing ΔmalT::cat This work
A. pleuropneumoniae MalT negative mutant of A. This work
CM5 3ΔmalT pleuropneumonaie CM5  
pCR4-TOPO A linearized plasmid for cloning PCR product Invitrogen
pEMOC2 A conjugation vector based on pBluesript SK with mob RP4 and Cmr Reference no. 31
pTOPOPCR-malT pCR4-TOPO containing malT of A. pleuropneumiae CM5 This work
pTopoMC pCR4-TOPO containing ΔmalT::cat This work
pEMOC2M harboring pEMOC2 containing ΔmalT::cat This work
malT-L
malT-R
ATGCAAGCAACATTTTCAAGA
TTAGCTATACCCCATCATTCTCAA
Primers for amplification of the malT gene of A
pleuropneumoniae CM5
stopupmalT-L TTAGTTAGTTACGAGCTTTTTCACACCGTTT Primers for generation of a linearized plasmid containing a deletion of 900 bp in its malT gene cloned in pTOPOPCR-malT.
stopupmalT-R TAACTAACTAATGGGAATGGCATCATTTAGA  
pnmalT-L TCATCTGCAGATGCAAGCAACATTTTCAAGA Primers for amplication of the ΔmalT::cat and the insertion of the Pst I and Not I sites into the PCR product.
pnmalT-R ACAATACAGCGGCCGCTTAGCTATACCCCATCATTCTCAA  
cat-L CGGTGCCCTGAATGAACT Primers for the PCR
cat-R AAGCTTCGACGAATTTCTGC amplification of omlA-P driven cat gene of pEMOC2