Skip to main content

Table 10 Oligonucleotide primers used in the real-time PCR

From: malT knockout mutation invokes a stringent type gene-expression profile in Actinobacillus pleuropneumoniae in bronchoalveolar fluid

Gene Forward primer Reverse primer
dmsA ATGTTGCCGGACAAGCACAAGATG TCTCAATGGACAACGGCTACCACA
dmsB AACAGGCATCGATTGCACCGTTAC ACTTGGACGTGCGTGTTTATTGGC
napB GCGCATGGCAACCTAAACATTGGT TACAGGCTTTGCAGTAGCGGAAAC
napD TCGGCTAAAGCAAGCTGTCTGTCA TAGCGCAAGTGAAAGCGGACATTC
napF ACAACCGTCTCCGCAACTTCTACA TTGGCTACAACGGAAGAAGCATGG
ilvH GAAAGTTTAACCGTTGCGCCGACT ACGTTCAATATGCTCGGTAGGGCT
pgaA GGGAACCGGTGTGAATGCAATGAA TGTTGGAACGTTTGTGAAGACGCC
pgaC ATCGTTGCGTTACACCAAGCGAAC ACCGACATACTTGCCTCTTGCGAT
apxIVA TTGGACTTCACCTGCAAACATGCC CGGGCAAATATTCCAAAGCGCAGA
relA TCGGACAGTTGAAGTGGGAAT TGCAAGGCGATTACTCGGTAA
syp AAGAAACGCCGAATGATGCACAGG ACACCTCGATAGCACCACCTTTGT
lamB CTGCTAAAGAGAGTTTACCGATGCCA TGCAACATTACGGGCAGGTAAACG
malK GCGTGTTGCAATTGGACGTACCTT CATGGCTTCGATTTGGTCATGCGT
malM AGCGACACCGTCAAAGACAGAACT CCAACGTTTGGCTAAATGTGCGGA
malT TCCTTGATGAGCTTTCGACCCACA TAAACCGAGCACCTGCCATTCTCT
malP ACGCTTAGCCGCCTGCTATTTAGA CACGCATCGCCTTCTTCATGTTGT
malQ ATGCCTATCGGCCTTTACCGTGAT ACCGACAGAGGCATCTAGCACAAA
malE AACCGATGAAGGACTCACAACCGT TTTCCGCATTCGCCATAGTTGCTG
malF TGCCGTTAATGATTGCCAGCTTCG GCAGCCGCTAAACCAAAGTCTTGT
malG AGTGTTACTCATGCGGACGGAAGT GCATACGCAGCAGTGGTTGAAAGT