Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Direct and negative regulation of the sycO-ypkA-ypoJ operon by cyclic AMP receptor protein (CRP) in Yersinia pestis

Target gene Primer sequence (5'→3')
EMSA (Sense/antisense)  
   sycO ATATTCTGGGACGGGTTT/TTCCTGCTGAGTTTCTGC
   YPO1099 AGCCCTCTCTCCCTAGCC/GCAGTTGCCAGACCGC
   YPO0180 GCTACCGAGCCTAACCC/AGGCACCCATCTCATGG
Real-time PCR or RT-PCR (Sense/antisense)  
   sycO GCCCTTGTTTCGCTTGGAGTG/AGTTCCTGCTGAGTTTCTGCTG
   ypkA GCTAAGATTGAACGCTCCATTG/TCAGAACAACGCCAACCATC
   yopJ AATCCAGGCGAACAATAAATATCC/CACTGAAATGTATTCCACCTTCC
   sycO-ypkA intergenic CAGGAACTGCCCCTTCATAC/ATACCGTTTTCCTCCGATATTGAG
   ypkA-yopJ intergenic TGCGAGAGCTGACGACCATC/TCATTACTGATTAAAGAACTGGTC
   lacA CCGATAACGATTGGCAATAACG/GCGAATAACCCGACAAGGAAC
   16s rRNA TTACCTACTCTTGACATCCAC/GCTGGCAACAAAGGATAAG
DNase I footprinting (Sense/antisense)  
   sycO CAGATTTGTCTACAGGTTCG/CTCAGCATAATAACGACTCGG
LacZ reporter fusion (Sense/antisense)  
   sycO GCGGAATTCAGGAACGGGAAGATTTAC/GCGGGATCCAATCTCTCTGCATGAACG
Primer extension  
   sycO CTCAGCATAATAACGACTCGG