Skip to main content

Table 1 Oligonucleotide probes included in the final microarray layout.

From: Rapid identification of bacterial pathogens using a PCR- and microarray-based assay

Targeted bacteria Sequence (5'->3') Length Tm (°C)
Acinetobacter baumannii AGTGTTTCAGATAATGGCC 19 47
  AATTATTGTCACGATTCACGAGG 23 52
Enterococcus faecalis CTGGTATCCCAACAGTAGAAGTA (parE) 23 53
Enterococcus faecium TATCACCGTTATTGACGACGGTC 23 55
  GGATACCTGTAGATATCCAGGCA 23 55
Haemophilus influenzae GGCCATTGTTCCGATATTATCG 22 53
  GTTCCGATATTATCGTGACAA 21 49
Klebsiella pneumoniae TACTGCAAAGATATCGTTGTCA 22 49
Listeria monocytogenes TACAATCGAAGCTGATAACAGCA 23 52
  ACTGTTCGTGATAACGGACGTGG 23 57
  GGTCGTCCAACAGTAGAAGT 20 52
Neisseria meningitidis AATCACGGTAACGATACACGC 21 52
Staphylococcus aureus CTGTCGAAGTTATTTTAACTGTTT 24 49
  AATAGTATCGATGAAGCATTAGCTG 25 53
Staphylococcus epidermidis TAGTCATATTGAAGTTRTAATTGAG 25 48–49
  CATTAGCAGGTTATGCTAGTCATA 24 52
CNS TCAACTTCAGAAAAAGGTTTACA 23 48
  CGCCCAGCAGTTGAAGTTATCT 22 55
Streptococcus agalactiae TTACATTGAACCAGATAACTCTA 23 48
  TGGAAGACCAGCTGTAGAGACAG 23 57
Streptococcus pneumoniae TGGTGATCGTATTGATGTAACTA (parE) 23 50
Streptococcus pyogenes GTCCCGCCGTTGAAACAGTT 20 54
  TTTTTACAGTCTTACACGCAGGT 23 52
  GCAGGTTTTGCCTCTCATATTAAAGTCTT 29 57
mecA TGATTATGGCTCAGGTACTGC 21 52
  TGGCTCAGGTACTGCTATCCA 21 54
  ATTAGCACTTGTAAGCACACC 21 50
  TACTGCTATCCACCCTCAAAC 21 52
  1. If not otherwise stated, the presented sequence targets the gyrB gene.
  2. Melting temperature (Tm, basic) is calculated using software available at http://www.basic.northwestern.edu/biotools/oligocalc.html.