Skip to main content

Table 2 Primers used in this study

From: Cj0596 is a periplasmic peptidyl prolyl cis-trans isomerase involved in Campylobacter jejuni motility, invasion, and colonization

Primer Sequence (5' → 3')
purprot-F CATATGGCTACAGTAGCTACTGTT
purprot-R CTCGAGTTTATATTCCACTTT
cj0596-F1 TTTTAGCTTTACAGGTGTAACG
cj0596-R1 ATCCACTCCATCTTCTTCGC
cj0596-inv1 ACCGGTTTTTAATAAAATGTATATAA
cj0596-inv2 ACCGGTTATGCTAGCAAAGTGGAATATAAATAATGGG
cat-F1 ACCGGTAAAACAATTGGGAGGATAAATGATGCAATT
cat-R1 GCTAGCTTATTTATTCAGCAAGTCTT
rpsL HP -F1 ACCGGTAACGACTAAAGTTTTAACA
rpsL HP -R1 CAATTGTCTTCAATCTTATTAAAAGCT
cj0597RT-F GACACAGATACTCAAATGGGC
cj0597RT-R CCAAACACGCGGATCATA
16S-RT-F GGGTGCTAGTCATCTCAGTAATGC
16S-RT-R GGTAAGGTTCTTCGCGTATCTTCG
purprot-F CATATGGCTACAGTAGCTACTGTT
purprot-R CTCGAGTTTATATTCCACTTT
  1. Bold nucleotides indicate restriction sites introduced for cloning purposes