Table 1 Primers and GenBank coding positions for the glycopeptidolipid (GPL) genes examined in this study
From: Biofilm formation by Mycobacterium avium isolates originating from humans, swine and birds
Gene | AF125999coding position | Primer sequence | Start-stop within gene (prod size in bp) |
|---|---|---|---|
merA | 15360–16379 | P102 tattgactggccctttggag | 452–659 (208) |
P103 gctttggcttcctcatatcg | |||
mtfF | 16655–17377 | P104 gctgccgatgcttaaaagtc | 342–499 (158) |
P105 gcttctcgaaaccctgtacg | |||
mdhtA | 14389–15420 | P106 gacccggatgaggtctacaa | 232–402 (171) |
P107 gaacatctccgacgaggaag | |||
rtfA | 4488–5774 | P108 ccattggtcgtgaactgatg | 56–214 (159) |
P109 ttttgaagaagtcccggatg | |||
gtfA | 2807–4084 | P112 ttctggaagatgggggagat | 223–400 (178) |
P113 gcggaaggtcgtaatactcg | |||
mtfC | 5876–6676 | P114 ggcgtgatctgaccaggtat | 44–266 (223) |
P115 tcttccagaaccgtttccac |