Skip to main content

Table 1 Primers and GenBank coding positions for the glycopeptidolipid (GPL) genes examined in this study

From: Biofilm formation by Mycobacterium avium isolates originating from humans, swine and birds

Gene AF125999coding position Primer sequence Start-stop within gene (prod size in bp)
merA 15360–16379 P102 tattgactggccctttggag 452–659 (208)
   P103 gctttggcttcctcatatcg  
mtfF 16655–17377 P104 gctgccgatgcttaaaagtc 342–499 (158)
   P105 gcttctcgaaaccctgtacg  
mdhtA 14389–15420 P106 gacccggatgaggtctacaa 232–402 (171)
   P107 gaacatctccgacgaggaag  
rtfA 4488–5774 P108 ccattggtcgtgaactgatg 56–214 (159)
   P109 ttttgaagaagtcccggatg  
gtfA 2807–4084 P112 ttctggaagatgggggagat 223–400 (178)
   P113 gcggaaggtcgtaatactcg  
mtfC 5876–6676 P114 ggcgtgatctgaccaggtat 44–266 (223)
   P115 tcttccagaaccgtttccac