Skip to main content

Table 2 The targeted genes and PCR primers used for the detection and the differentiation of Cp. abortus, Cp pecorum and C. burnetii.

From: Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant's clinical samples using multiplex PCR

Target gene Primers name Primers sequence (5'-3') Amplified fragment length (bp) Melting temperature (°C)
pmp 90/91 pmp-F CTCACCATTGTCTCAGGTGGA 821 64
  pmp-R821 ACCGTAATGGGTAGGAGGGGT   66.3
CPC Cpc-F TTCGACTTCGCTTCTTACGC 526 64.3
  Cpc-R TGAAGACCGAGCAAACCACC   67.4
IS1111a Trans-1 TATGTATCCACCGTAGCCAGT 687 67.5
  Trans-2 CCCAACAACACCTCCTTATTC   66
  1. The name, the sequence, the target gene and the predicted amplified fragment, as well as the melting temperature are listed.