Skip to main content

Advertisement

Table 2 Sequences of primers used for the pentaplex PCR.

From: A pentaplex PCR assay for the rapid detection of methicillin-resistant Staphylococcus aureus and Panton-Valentine Leucocidin

Gene Primer Name 5'---------------------------------3' Gen Bank accession number Product size
Internal IC-F AGCAGCGTCCATTGTGAGA AF227752 759 bp
control hem M IC-R ATTCTCAGATATGTGTGG   
16S rRNA 16S rRNA-F GCAAGCGTTATCCGGATTT D83356 597 bp
  16S rRNA-R CTTAATGATGGCAACTAAGC   
fem A fem A-F CGATCCATATTTACCATATCA CP000255 450 bp
  fem A-R ATCACGCTCTTCGTTTAGTT   
mec A mec A-F ACGAGTAGATGCTCAATATAA NC_003923M 293 bp
  mec A-R CTTAGTTCTTTAGCGATTGC   
luk S lukS-F CAGGAGGTAATGGTTCATTT AB186917 151 bp
  lukS-R ATGTCCAGACATTTTACCTAA