Skip to main content

Table 2 Oligonucleotide primers

From: Chitobiose utilization in Borrelia burgdorferi is dually regulated by RpoD and RpoS

Primer Name Sequence (5'→3')
BB0771 F1 CTTGCAGGACAAATACAAAGAGGC
BB0771 R1 GCAGCTCTTATTAATCCCAAGTTGCC
BB0450 mutF1 TTCTCCTCTTGGAACCATTCCGGT
BB0450 mutR1 ACCATAACCTACCACGCCCTCAAT
BB0450 mut confirm F1 GGTTCCATAATATGTTCTCCCTTTCTCAG
BB0450 mut confirm R1 CCCAACGCTCGAATTTAAAGACCC
5' ErmC seq out GGCCTTTTCCTGAGCCGATTTCAAAG
3' ErmC seq out TTCCTTAAAACATGCAGGAATTGACG
chbC F GGGAATTCAGCCCAATTCATGGTTTCC
chbC R GGCGGAACAGACTCTGGAAGCTTAAT
BBB04 5'RACE R1 GCTACAATTGAAAGCGCAACAACAGG
Oligo(dT) AP GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV
Oligo(dC) AP GACCACGCGTATCGATGTCGACCCCCCCCCCCCCCCCC
BBB04 5'RACE R2 AGCAGCATCTCCACCGTAAGGTAT