Skip to main content

Table 1 Plasmids, Strains and Oligonucleotides

From: Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

  PLASMID  
Name Description Reference
pTV1-OK Temperature sensitive plasmid for the delivery of Tn917. 11 kb. EryR KanR. [33]
pNZ272 Lactococcal beta-glucuronidase (gusA) transcriptional fusion vector. 4.6 kb. CmR. [34]
pIMC Site-specific Listerial integrative vector. High-level CmR from Phelp driven expression. 4.6 kb. CmR. This study
pIMK3 Site-specific Listerial integrative vector. High level IPTG controlled gene expression. 7.5 kb. KanR. [27]
pIMC3kan Site-specific Listerial integrative vector. IPTG controlled expression of aphA-III ex pTV1-OK. CmR [33] This study
pIMC3gus Site-specific Listerial integrative vector. IPTG controlled expression of gusA ex pNZ272. CmR [34] This study
pIMC3ery Site-specific Listerial integrative vector. IPTG controlled expression of ermAM ex pTV1-OK. CmR [33] This study
pIMC3tet Site-specific Listerial integrative vector. IPTG controlled expression of tetM ex CH919. CmR [35] This study
  BACTERIA  
Listeria monocytogenes   
EGDe Wild type 1/2a strain. Genome sequenced. [9]
10403S Wild type 1/2a strain. Genome sequenced. Broad Institute (MIT). [36]
F2365 Wild type 4b strain. Genome sequenced. [10]
EGDe::pIMC3kan EGDe transformed with pIMC3kan integrated at the tRNAARG. This study
EGDe::pIMC3gus EGDe transformed with pIMC3gus integrated at the tRNAARG. This study
EGDe::pIMC3ery EGDe transformed with pIMC3ery integrated at the tRNAARG. This study
EGDe::pIMC3tet EGDe transformed with pIMC3tet integrated at the tRNAARG. This study
10403S::pIMC3ery 10403S transformed with pIMC3ery integrated at the tRNAARG. This study
F2365::pIMC3tet F2365 transformed with pIMCtet integrated at the tRNAARG. This study
Other Bacteria   
DH10B Wild type Escherichia coli. Used for routine cloning. Invitrogen
CH919 MG1363 Lactococcus lactis subsp. lactis containing Tn919. [36]
  OLIGONUCLEOTIDE  
Name 5'-3' a RE site
108 Phelp B REV CATGGGTTTCACTCTCCTTCTAC  
181 CAT C FWD AAATGTAGAAGGAGAGTGAAACCCATGAACTTTAATAAAATTGATTTAGAC  
203 MCS FWD AATTAACCCTCACTAAAGGGAAC  
204 MCS REV GACGTCGTAATACGACTCACTATAGGGC  
205 Back FWD AGTGAGTCGTATTACGACGTCCCAGGGCTTCCCGGTATCAAC  
206 Phelp A FWD ATCCCATTATGCTTTGGCAGTTTATTC  
209 CAT D REV ATAATGAGACAGAATTATGATGATCATATGTCAACTAACGGGGCAGG  
211 Back REV CATATGATCATCATAATTCTGTCTCATTATATAAC  
373 gusA FWD TATACCATGG TACGTCCTGTAGAAACCCCAACC Nco I
374 gusA REV ATATCTGCAG TTATTGTTTGCCTCCCTGCTGCGG Pst I
385 aphA3 FWD TAATCCATGG CTAAAATGAGAATATCACCGGAATTG Nco I
386 aphA3 REV AAGCCTGCAG TTAAAGCTTTTTAGACATCTAAATCTAGG Pst I
387 ermAM FWD ATATCCATGG ACAAAAATATAAAATATTCTCAAAAC Nco I
388 ermAM REV ATATCTGCAG TTATTTCCTCCCGTTAAATAATAGATAAC Pst I
408 tetM FWD ATATCCATGG AAATTATTAATATTGGAGTTTTAGC Nco I
409 tetM REV ATATCTGCAG TTAAGTTATTTTATTGAACATATATCG Pst I
  1. a Restriction sites are in bold type