Skip to main content

Table 2 Primer sequences and PCR product size used for S. Enteritidis typing

From: Multi-locus variable-number tandem repeat analysis for outbreak studies of Salmonella enterica serotype Enteritidis

Locus Primer Dye-Sequence DNA sequence length in bpa (size ABI 310b)
SENTR1 SENTR1-F HEX-GCAACAGCAGCAGCAACAG 440 (415)
  SENTR1-R CCGAGCTGAGATCGCCAAG  
SENTR2 SENTR2-F FAM-CACTGGACGATCTGGATTTCTC 519 (510)
  SENTR2-R GTCGCCGTTACGCATCAAC  
SENTR3 SENTR3-F TET-CTAAACAAGCCGCTCATCCG 494 (480)
  SENTR3-R ACAACCTGCTGCTGTGCTG  
SENTR4 SENTR4-F HEX-GACCAACACTCTATGAACCAATG 120 (120)
  SENTR4-R ACCAGGCAACTATTCGCTATC  
SENTR5 SENTR5-F FAM-CACCGCACAATCAGTGGAAC 271 (270)
  SENTR5-R GCGTTGAATATCGGCAGCATG  
SENTR6 SENTR6-F TET-ATGGACGGAGGCGATAGAC 180 (177)
  SENTR6-R AGCTTCACAATTTGCGTATTCG  
SENTR7 SENTR7-F FAM-ACGATCACCACGGTCACTTC 135 (133)
  SENTR7-R CGGATAACAACAGGACGCTTC  
SE-3 SE-3F HEX- CAACAAAACAACAGCAGCAT 308 (307)
  SE-3R GGGAAACGGTAATCAGAAAGT  
SE-7 SE-7F HEX- GATAATGCTGCCGTTGGTAA 717 (691)
  SE-7R ACTGCGTTTGGTTTCTTTTCT  
  1. a based on S. Enteritidis NCTC 13349 [25].
  2. b size analysed using the capillary sequence detection system ABI 310 (Applied Biosystems)