Skip to main content

Advertisement

Table 2 qRT-PCR primers used in this study

From: Variation in expression of HMW1 and HMW2 adhesins in invasive nontypeable Haemophilus influenzae isolates

Primer set Strain/gene amplified Nucleotide sequence (5' to 3') Reference sequence Size, bp
gyrAfrw All/gyraseA GCGTGTTGTGGGTGATGTAA L42023 82
gyrArev   GTTGTGCCATACGAACGATG   
hmw1Afrw Hi12, Hi56/ CCGGTGGTTTTGTGGAGACGTCG M84616 133
hmw1Arev hmw1A TGAAGTATTGCTGCGTCCTG   
hmw2Afrw Hi12, Hi56/ CCGGTGGTTTTGTGGAGACATCG M84615 121
hmw2Arev hmw2A GCGAAGGGGGTCTTCGGCTTCA   
72.1Afrw Hi72/ CCGGTGGTTTCGTGGAGACATCA AJ937359 184
72.1Arev hmw1A GCGTTCAGGTTCATTTGATGCACTTTCTA   
72.2Afrw Hi72/ CCGGTGGTTTCGTGGAGACATCA AJ937360 178
72.2Arev hmw2A GACATTATTGTTATAGATTGTTTCTGTGGTGTA   
91.1Afrw Hi91/ CTGGCGGCTTTGTGGAAACGTCA AJ920372 174
91.1Arev hmw1A GAGCTCTCGGTACCTAGACCAGT   
91.2Afrw Hi91/ ACTGGTGGTTTTGTGGAGACATCAGG AJ937352 158
91.2Arev hmw2A CTTATTGGGGTTATCGCCTCTAGATATT