Skip to main content

Table 3 Oligonucleotide primers used for cloning and PCR confirmation.

From: Assessment of decorin-binding protein A to the infectivity of Borrelia burgdorferi in the murine models of needle and tick infection

Designation Sequence
ko1 GGATCTTAAGAATTTCAAATTTT
ko2 TATAGGCGCGCC AATACTACATGCGACCAATa
ko3 TATAGGCGCGCC TGAAGAGAATCCTCCAACTa
ko4 TTTAGATTCTAAAGTTTAGATAAAAATTGGTCGGG
ko5 AAACAAGTCTTAAAATCACAAGC
kan5' AGCCATATTCAACGGGAAACG
kan3' TTCATATCAGGATTATCAATACC
vlsE-5' GATGCAGAGAAGGCTGCTGCTGCAGTTAGTGC
vlsE-3' TATAAGCTTTCATCAGAGAGTCTTATTAACAGCAGTCTCAAC
BBE22-5' AAATTAATTTCTTTGATCAACCAAC
BBE22-3' TATATTAAGCTTACTTTGGCTGTCG
FlaB5' ATGATTATCAATCATAATACATCAGCTATTAA
FlaB3' TTATCTAAGCAATGACAAAACATATTGGGGAA
comp1 GGCTTCTCTTTTATTTTTAAGACC
comp2 CATATG TTCCTCCTTCTATTAAATTTAGTTAAATTTAAATTTTAGCCCACb
comp3 AGATCTCATATG ATTAAATGTAATAATAAAACTTTb
comp4 GCATGC CTTTGGGTTAATTGCTTTAACc
comp5 GTAGCTCCACTTTTGCTTC
  1. a Asc I site underlined.
  2. b Nde I site underlined.
  3. c Sph I site underlined