Skip to main content

Table 5 Oligonucleotides used for amplification of C. dubliniensis and C. parapsilosis CNH1 genes. Sections homologous to CNH1 genes are underlined.

From: Functional comparison of plasma-membrane Na+/H+ antiporters from two pathogenic Candida species

Primer Sequence (5'-3')
CdCNH1-F TTTTTTGTACATTATAAAAAAAAATCCTGAACTTAGCTAGATCTTATGGCTTGGAGTCAGTTAGAA
CdCNH1-R ACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGCATGCTACTCCTCTTCATCTTCTCT
CdCNH1-GFP-R CATTTTAATAAAGCTCCGGAGCTTGCATGCCTGCAGGTCGACCTCCTCTTCATCTTCTCTATC
CpCNH1-F TTTTTTGTACATTATAAAAAAAAATCCTGAACTTAGCTAGATCTTATGGTATGGAGTCAACTAGAA
CpCNH1-R ACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGCATGCTATTCCTCGTCATTTTGATC
CpCNH1-GFP-R CATTTTAATAAAGCTCCGGAGCTTGCATGCCTGCAGGTCGACTTCCTCGTCATTTTGATCACG