Skip to main content

Table 3 DDT sequencing of regions showing different whole genome fingerprint profiles in SS14 strain

From: Complete genome sequence of Treponema pallidum ssp. pallidumstrain SS14 determined with oligonucleotide arrays

Region no. ORFa Difference from WGF on the gel Size of sequenced region (nt)b Left coordinatea Right coordinatea Newly found changes Confirmation of SNPs identified by CGSc
1 TP0124–TP0134 insertion 3245 + 1255 insertion 145858 149102 1255 nt insertion, 2 nt deletion -
    1362 149563 150924 - -
    252 151648 151899 - -
    3465 152043 155507 1 nt insertion 2 SNPs
2 TP0135–TP0138 deletion 662 155686 156347 - (+ 64 nt deletion as in Table 1)
    894 158391 159284 1 nt deletion  
3 TP0433–TP0434 insertion 481 + 419 insertion 461058 461538 insertion of 7 repeats of 60 nt region altogether 14 repetitions, consensus sequence of the repeat CGTGAGGTGGAGGACGYGCCGRRGGTAGTG GAGCCGGCCTCTGRGCRTGARGGAGGGGAG -
4 TP0468–TP0471 deletion 3571 495308 498878 2 nt deletion + 1 nt insertion + deletion of seven 24 nt repetitions, consensus sequence of the repeat CTCCGCCTCCTTGCGCCGGGCTTC 1 SNP
  1. nt – nucleotide; SNP – single nucleotide polymorphism; aas described in [3]; bregions previously described in Table 1 were excluded; cSNPs identified using CGS in these regions were verified by DDT sequencing.
Back to article page