Skip to main content

Table 2 Primers

From: Sequence diversity in the A domain of Staphylococcus aureusfibronectin-binding protein A

Primer Sequence (5' – 3')*
Flanking primers  
pfnbA Adom F CCGAAGCTTGTGAAAAACAATCTTAGGTAC
pfnbA Adom R CCGGGATCCTATCAATAGCTGATGAATCCG
Type-specific probe primers  
pfnbA N3 I F AAAGGTAGTAATCAAATGG
pfnbA N3 I R GTTAAGGTATATCCTCTATC
pfnbA N3 II F GATAGTGTTACTGTAACGG
pfnbA N3 II R TAGCGATTTTCAGGGTATC
pfnbA N3 III F TAGTAATTTAGCTGGTGGAC
pfnbA N3 III R GATATCCCCCATAAACATAG
pfnbA N3 IV F CAAAGCAAATGGAAATGCTC
pfnbA N3 IVR AGTTGGTATCCCAAATGAG
pfnbA N3 V F GAAAGGTAGCAACTCTAATG
pfnbA N3 V R TGTTAATGTATAGCCGTGG
pQE30 expression vector primers  
pfnbApQE II F CGCGGATCCGGTACAGATGTGACAAGTAAAC
pfnbApQE II R CCGAAGCTTATATTTTCCATCACCATTAGC
pfnbApQE III F CGCGGATCCGGTACAGATGTGACAAGTAAAG
pfnbApQE III R CCGAAGCTTATTTTTACCATTGCCGTCAG
pfnbApQE V F CCGGGATCCGGCACAGATGTTACAAGTAAAG
pfnbApQE V R CCGAAGCTTATATTTTCCATCACCATTAGC
pfnbApQE VI F CTAGGATCCGGCACAGATGTGACAAGTAAAG
pfnbApQE VI R CCGAAGCTTATTTTTACCATTACCATCAGC
pfnbApQE VII F CCGGGATCCGGTACAGATGTGACAAGTAAAG
pfnbApQE VII R CCGAAGCTTATTTTGACCATTACCATCTGC
  1. *restriction endonuclease sites underlined
\