Table 3 Conserved sequences in the intergenic regions of the extended hyp-operon in Nostoc sp. strain PCC 7120 (Fig. 1A and Fig. 4))
From: Transcription of the extended hyp-operon in Nostocsp. strain PCC 7120
Intergenic regions (R) | Conserved sequences (cs) | Length (nt) | Appearances in the genome | Hairpin formation energy ΔG (kcal mol-1) | Distance from translational start point (nt) |
|---|---|---|---|---|---|
R1 hupS-asr0689 | csR1.1: ttgtcagttgtcagttgtca | 20 | 44 | no hairpin | 476 |
csR1.2: ttgttagttgttag | 14 | 11 | no hairpin | 455 | |
csR1.3: ccactgactactgac | 15 | 14 | no hairpin | 391 | |
R2 alr0691-0692 | csR2: agacgcgatt(c/a)atcgcgtct | 20 | 34 | -10,5 | 49 |
R3 alr0693-hypF | csR3.1: ggagggtttccctcc | 15 | 19 | -6,1 | 81 |
csR3.2: aacttttcaaga | 12 | 21 | no hairpin | 60 | |
R4 hypF-hypC | csR4: attgcgaattg | 11 | 79 + 26 (alpha plasmid) | -1,3 | 49 |
R5 asr0701-alr0702 | csR5.1: aaatccctatcagggattgaaac | 23 | 32 | -5,8 | 256 |
csR5.2: aaatccctatcagggattgaaac | 23 | 32 | -5,8 | 186 | |
R6 alr0702-all0703 | csR6: taggggtgtaggggt | 15 | 61 | no hairpin | a |