Skip to main content

Table 1 Primers

From: Cell division in Escherichia colicultures monitored at single cell resolution

Name Sequence
dpsF 5'AATCTAGACTCGCTACTTTTCCTCTACACC3'
dpsR 5'AACATATGTTCATATCCTCTTGATGTTATGTCC3'
gadAF 5'AATCTAGATTTGATCGCCCGAACAGCAATG3'
gadAR 5'AACATATGGAACTCCTTAAATTTATTTGAAGGC3'
katEF 5'AATCTAGACTGTAGTTTAGCCGATTTAGCC3'
katER 5'AACATATGACTCGTCTCCTTAATTTATTACTG3'
osmEF 5'AATCTAGACCTTAAAGCTAACCCGTTGCTACTG3'
osmER 5'AACATATGCCGTCCTCTTGTTTATCAGCGTGTTAG3'
rpoSF 5'AAAAGCTTGCGCAACAATATTCAGGCACCATACG3'
rpoSR 5'AACATATGAGGTGGCTCCTACCCGTGATCCC3'