Skip to main content

Advertisement

Table 3 Primers used in this study

From: Distribution of transferrin binding protein B gene (tbpB) variants among Neisseriaspecies

Primer Primer base sequence (5' – 3') Application Location from 5' end
OTG6687 CAATCCATTGGTAAATCAG tbpB forward primer 6
OTG6689 [54] GCCGTCTGAAGCCTTATTC tbpB reverse primer Intergenic space
seqtbpBI-for1 CTAYAAAGGSARHRAWCCTTCC Isotype I tbpB sequencing 603
seqtbpBI-for2 CCGATTTYGGKMTGACYAG Isotype I tbpB sequencing 817
seqtbpBI-rev1 CCRCCTTCCTGATTGGAGG Isotype I tbpB sequencing 1931
seqtbpBI-rev2 CTGAAATGCCGCCTTATTGCC Isotype I tbpB sequencing 1486
seqtbpBII-for1 GACGGYTATATYTTYTATMAMGG Isotype II tbpB sequencing 585
seqtbpBII-for2 GAAACCAARSAACATCCCTTTG Isotype II tbpB sequencing 1032
seqtbpBII-rev1 GAAGCATTGCCGCTCCAGC Isotype II tbpB sequencing 1901
seqtbpBII-rev2 CTGTTCCGCCGTTTKTACC Isotype II tbpB sequencing 1460