Skip to main content

Table 2 Sequence characteristics of the hybridization probes on the AT genotyping microarray

From: Genotyping of Chlamydophila psittaci using a new DNA microarray assay based on sequence analysis of ompA genes

Probe Sequence* Binding site* Length GC/% Tm/°C
VD2-01 GGAATTGCTGGAAATAGCGAAAGTAATGC AF269269.1 [466:494] 29 41 60.9
VD2-02 GGTTTTCAGCTGCAAGCTCAATCTC M73035.1 [554:578] 25 48 60.3
VD2-03 GGTTTTCAGCTACCAACTCAACCTCT AF269265.1 [488:513] 26 46 60.3
VD2-04 GGTTTTCAGCTACCAGCTCAACCT AY327465.1 [488:511] 24 50 60.3
VD2-11 AGGAAACACCTTAACAAATGACCGACT AJ310735.1 [483:509] 27 41 60.2
VD2-12 GCTACCAACTCAACCTCTACCGATCT AF269265.1 [496:521] 26 50 61.0
VD2-13 GAGCCTCTTTATCAGAGCAACTTCCA AJ243525.1 [324:349] 26 46 60.0
VD2-14 AGCTCCTTAACAAATGACCAACTTCCC AF269260.1 [478:504] 27 44 60.7
VD2-15 CCAGCTCAACCTCTACCGAGCT AY327465.1 [500:521] 22 59 61.0
VD2-21 CCGTAGCAGCTGATCAACTTCCA AF269259.1 [482:504] 23 52 60.1
VD2-22 GCAGTTAGTACCGATCTTCCAAAGCA AF269268.1 [505:530] 26 46 60.5
VD2-23 TCAATAATCAACTTCCAAACGTAGCCATCA AF269266.1 [494:523] 30 37 60.6
VD2-24 CTCTACCGAGCTTCCAATGCAACT AY327465.1 [510:533] 24 50 60.2
VD2-25 CTCTACCGATCTTCCAACGCAACT AF269281.1 [738:761] 24 50 60.0
VD2-31 CGATCTTCCAACGCAACTTCCTAAC AF269281.1 [744:768] 25 48 59.7
VD2-32 CGATCTTCCAATGCAACTTCCTAACG M73035.1 [582:607] 26 46 59.9
VD2-33 CGATCTTCCAAAGCAACTTCCTAACG AF269268.1 [516:541] 26 46 59.8
VD2-34 CGAGCTTCCAATGCAACTTCCTAAC AY327465.1 [516:540] 25 48 59.9
VD4-01 TGGCTACTGCTGTTTTAGACGCA AF269269.1 [923:945] 23 48 59.9
VD4-02 TGGCCTCTGCTGTTATGAACTTGAC AF269260.1 [914:938] 25 48 60.5
VD4-03 AGCCGCTGCTGTTTTGAACTTGA AF269259.1 [915:937] 23 48 61.2
VD4-11 CCCAAGCCTTATAGGATCAACCACTG M73035.1 [1047:1072] 26 50 60.3
VD4-12 CCAAGCCTTCTAGGATCAACCACTG AF269265.1 [982:1006] 25 52 60.3
VD4-13 CCAAGCCTTGTAGGATCAACCACTG M73035.1 [1048:1072] 25 52 60.8
VD4-21 CCTTATAGGATCAACCACTGCTTTGCC M73035.1 [1053:1079] 27 48 61.1
VD4-22 CCTTCTAGGATCAACCACTACTTTGCC AF269262.1 [927:953] 27 48 60.4
VD4-23 CCTTTTAGGGGAAGCCACAAATTTAGACT AJ243525.1 [799:827] 29 41 60.7
VD4-24 CCTTCTAGGATCAACCACTGCTTTGC AF269265.1 [987:1012] 26 50 61.2
VD4-25 AGGGCAAGCTACAAATTTAGATACTAGCA AJ310735.1 [969:997] 29 38 59.7
VD4-31 ACTACTTTGCCCAATAATGGTGGTAAGG AF269262.1 [943:970] 28 43 60.4
VD4-32 CTGCTTTGCCCAATAATAATAGTGGTAAGG Y16561.1 [1004:1033] 30 40 59.8
VD4-33 TGCTTTGCCCAATAATAGTGGTAAGGA M73035.1 [1071:1097] 27 41 59.8
VD4-34 AGCTTTAGATGCTAGCAACAAATTCTGC AF269259.1 [972:999] 28 39 60.1
VD4-35 GCTTTGCCCAATAATGCTGGTAAGG AY327465.1 [1006:1030] 25 48 60.2
VD4-36 TGTCGACGGTACCAATACTTACTCTGA AF269266.1 [981:1007] 27 44 60.3
mean    25 47 60.4
  1. *The exact binding position is referenced by the uniform sequence address (USA). This is the standard sequence notation scheme of the emboss software suite http://emboss.sourceforge.net/docs/.
\