Skip to main content

Table 1 Probes used in the TRAC analysis

From: Transcription of hexose transporters of Saccharomyces cerevisiaeis affected by change in oxygen provision

Gene Probe sequence Positiona
HXT1 ATGGTCAGGTGGGCATTTGTTAACTTTAGCTAA 826
HXT2 TAACTCACCCCAAGAAGCGTTACCG 891
HXT3 ATACCAATGGCACCATATAACAAACAGTTACGACGTC 1145
HXT4 CTGGATCGTCTGCGCTGACCTTATTTGAAAGAGCAATAG 842
HXT5 ATCATACCCATTAGTGTACGTCTGAAC 1026
HXT6 CATCTTGCCATACAATATAAATCGTAAGGGTTCAT +78
HXT7 GTATATATTAAAAACGTATTTACTTTTCAAGATATCATTAAAA +83
HXT8 AGAAGGGTTTCTCGTCATGCTGTAATTTTTCGT 1661
HXT9 ATGCTCAGTTTTTACAGATGGTGCATTTGCTACTGAG 60
HXT10 TGGCCAAAGACCTTCTAGCTTCTTCATACTTACCTTTTTCTAC 742
HXT11 GGCTCATTGGCATCTAGGTTAAGGGAATT 109
HXT13 ATCTCGAACATCTCCATCGCTATCAATAGAGGATT 14
HXT14 TATGGCCCTCGTTCTTAGAGGGAACAATTCG 1386
HXT15/16 GCCCATGTCGTTGCAAAGCAGAATATATAGAAGCATGTG 1284
HXT17 GACCATCCTGAATATCTCTATCACT 19
SNF3 TCTGTACTAGTAGGAATATCAACACGTTCTG 1892
RGT2 TTCACTTGTTTTGAAACAATCTAAAAGTGTTGACGGGCCGA 1007
GAL2 AGAGGCCAACGCCATACATTTCGACTTGA 1397
  1. a The start position of the probe inside the coding region. + indicates that the probe sequence is on the 3' side of the stop codon and the position is given relative to the stop codon.