Skip to main content

Table 3 Sequences of PCR primers used for RT-qPCR

From: par genes in Mycobacterium bovis and Mycobacterium smegmatisare arranged in an operon transcribed from "SigGC" promoters

parAB expression
Gene Forward (5'→3') Reverse (5'→3') Amplicon (bp) Coordinates (5', 3')
parA (Mb) aagtgttgcggacggtgattc ggtcacgctcggcaagttc 140 +874, +1014
parB (Mb) gcgtaagccgattcagatgcc ccgagccgaactccaccac 122 +833, +954
parA (Ms) acgacggccgcaccaagct gtcgagatagctcagtgctcc 177 +754, +930
parB (Ms) cgtaagccgatccagatgcca tcgttctgggcgctcatcag 171 +882, +1052
Co-transcription
Region Forward (5'→3') Reverse (5'→3') Amplicon (bp) Coordinates (5', 3')
orf60K-jag (Mb) aatgcggcagccccaacag tcggtggtgtcagcgtcg 256 -233, +23
jag-gidB (Mb) ccagaacgccgagtcgttgtgc gtccgaagatcgcagacgc 204 -164, +40
gidB-parA (Mb) gcggttgatgtcagggtggtg cgtcggtgtcggtggtgtc 236 -124, +112
parA-parB (Mb) gcgttggagggtgtgtcg ccctttctgcgtgacggc 352 -326, +26
orf60K-jag (Ms) gctccgccaccgaactgac gcgtccgcagcgagagtg 187 -184, +3
jag-gidB (Ms) ttccgccgcctcaagcc cacgccctgtcctttgttctg 199 -124, +75
gidB-parA (Ms) atgctcccgatcaaaggc cgaacccatgctcatctcc 230 -215, +15
parA-parB (Ms) cctcgcagtgtgaaggtctcg cggctgattcatgctcgtctcc 212 -200, +12
  1. Normalization was performed using primers for 16S rRNA amplification previously published [50]