Skip to main content

Table 4 Oligonucleotide primers

From: Multi locus sequence typing of Chlamydiales: clonal groupings within the obligate intracellular bacteria Chlamydia trachomatis

Target gene Forward primer Reversed primer
gatA GCTTTAGAATTARSARAWGCT GATCCTCCGGTATCYGATCC
oppA_3 ATGCGCAAGATATCAGTGGG AAAGCTCCRSTWGMTATMGGWAG
hflX GCTTCTARAGTACTTTTAAATG TATTTRGAAATYTTTKCSAGYCG
gidA GGAGTCWCTACWAAAGAAGG TCGTAYTGYACATCRAAAGG
enoA CCTATGATGAATCTKATCAATGG TCTTCTTCRGCWAGMCCATCT
hemN AGATCTTCTTCWGGRGGWAGAGA TTCYTTCAKAACSTAGGTTTT
fumC ATTAAAAAATGTGCTGCT CCTTCAGGAACATTYAACCC
  1. R = A or G; S = G or C; W = A or T; Y = C or T; M = A or C; K = G or T;