Skip to main content

Advertisement

Table 1 Primers used to construct major fimbrial subunit mutations in S. Enteritidis P125109

From: Analysis of the role of 13 major fimbrial subunits in colonisation of the chicken intestines by Salmonella enterica serovar Enteritidis reveals a role for a novel locus

Name Sequence (5'-3')
stbAFmut ATGTCTATGAAAAAATATTTAGCAATGATCACAGGCTCGCTGTGTAGGCTGGAGCTGCTTCG
stbARmut TTATTTATACGAAACGGCGTATTGTAGGGTGGCAGCGACTCATATGAATATCCTCCTTA
pegAFmut ATGAAACGTTCACTTATTGCTGCTTCTGTATTGTCTGCTGTGTGTAGGCTGGAGCTGCTTCG
pegARmut TTAATCAGTTAATACCGTCATCGTCAGTACAGATTCAACACATATGAATATCCTCCTTA
stdAFmut GTGCTTCGTTTAACACCAGGCGTTTATTATTCATACGAATTGTGTAGGCTGGAGCTGCTTCG
stdARmut TCACAGGTATTTCAGGGTGTAGGTGACGGATGCGTTGAAGCATATGAATATCCTCCTTA
steAFmut ATGAAGTCATCTCATTTTTGTAAACTGGCAGTAACTGCATGTGTAGGCTGGAGCTGCTTCG
steARmut TTACAGGTAAGAGATAGTGACGTTGGCGGCGCTGCTGAACATATGAATATCCTCCTTA
stfAFmut ATGAATACAGCAGTAAAAGCTGCGGTTGCTGCCGCACTGGTGTGTAGGCTGGAGCTGCTTCG
stfARmut TTACAGATAGCTGATCGTGAAGTTTACGGTGCTGCTGAATCATATGAATATCCTCCTTA
sthAFmut ATGTTTAATAAGAAAATTATCATCCTGGCAATGTTAACTTGTGTAGGCTGGAGCTGCTTCG
sthARmut TTACTGATACGAAACGGTATACGTAACCTGAGTGCTAACACATATGAATATCCTCCTTA
stiAFmut ATGAAACTCTCCTTAAAAACACTCACTGTGGCACTGCCGTGTGTAGGCTGGAGCTGCTTCG
stiARmut TCAGTTATATTGCAGATAGAATGTTGCGGTTGCATCGACCCATATGAATATCCTCCTTA
bcfAFmut ATGAAAAAGCCTGTACTAGCATTAATGGTCTCTGCCATTGTGTGTAGGCTGGAGCTGCTTC
bcfARmut TCAGGAATAAACCATGCTAAATGTCGCCGTCGCGGTAACCATATGAATATCCTCCTTA
csgAFmut ATGAAACTTTTAAAAGTGGCAGCATTCGCAGCAATCGTAGTTGTGTAGGCTGGAGCTGCTTCG
csgARmut TTAATACTGGTTAGCCGTGGCGTTGTTGCCAAAACCAACCCATATGAATATCCTCCTTA
lpfAFmut ATGGAGTTTTTAATGAAAAAGGTTGTTTTTGCTCTGTCTGTGTGTAGGCTGGAGCTGCTTCG
lpfARmut TTATTCGTAGGACAGGTTGAAGTCACTTCTGCGTTACCGCATATGAATATCCTCCTTA
fimAFmut ACCTCTACTATTGCGAGTCTGATGTTTGTCGCTGGCGCATGTGTAGGCTGGAGCTGCTTCG
fimARmut TTATTCGTATTTCATGATAAAGGTGGCGTCGGCATTAGCCTGCATATGAATATCCTCCTTA
sefAFmut ATGCGTAAATCAGCATCTGCAGTAGCAGTTCTTGCTTTAATGTGTAGGCTGGAGCTGCTTCG
sefARmut GTTTTGATACTGCTGAACGTAGAAGGTCGCAGTGGGTCCATTTCATATGAATATCCTCCTTA
safAFmut GTGGTTATTCAAATGAAAAGCATAAAAAAATTGATTATCGTGTGTAGGCTGGAGCTGCTTCG
safARmut TTAAGGCTGATATCCCACTACGTCTACAGTTATTGGGTACCATATGAATATCCTCCTTA
  1. The primers were designed to mutate the major fimbrial subunit by lambda Red recombinase-mediated integration of linear PCR products. Forward and reverse primers were used to amplify the pKD3-derived chloramphenicol cassette and contain 40 bp homology extensions 5' and 3' of the target gene.