Skip to main content

Advertisement

Table 1 Oligonucleotide primers used in this study

From: Functional identification of HugZ, a heme oxygenase from Helicobacter pylori

Primer Sequence(5' → 3') Characteristics Functions (genes)
H1 CGCGCATATGCTTAATCGTATC NdeI To amplify gene hugZ
H2 GGCCTCGAGTTTCTTGTGAGCG XhoI  
LA-F1 CGAGCTCCCATTACTACTGCTACTACTA SacI To amplify left arm of gene hugZ (LA)
LA-R1 GCTCTAGAGCACCGCTCATAAGGGGCAA XbaI  
RA-F1 TCCCCCGGGGGAAATATTCTCCTTAGTT SmaI To amplify right arm of gene hugZ (RA)
RA-R1 ACGTCGACGCAATGCTTTTAGAAATTAA SalI  
H-F TCGCTAAACAAACAGAATCAA / To detect hugZ
H-R ATGTGTTCTATGATACGATTAAGCAT /  
P-F GCTCTAGAGCTTGCCCCTTATGAGCGGT / To detect hugZ or cam
P-R CTTATTTTTTGAAACTAAGGAGAATATT /  
hugZ-1 TTGGGCAAGTCCATCACG 245 bp RT-PCR/Real-time RT-PCR Evaluation of hugZ
hugZ-2 GGTCGCTAAACAAACAGAA   
gyrB-1 CGCTAAAGAAAGTGGCACGA 267 bp RT-PCR/Real-time RT-PCR Evaluation of gyrB (normalizer)
gyrB-2 TGCGCGTTTCTTCATCCAT   
  1. The underlined sequences are the restriction sites. /: Absence of restriction endoenzyme sites.