Skip to main content

Table 2 Primer sequences, size and location of DNA fragments in the omcB gene.

From: Evaluation of an in silico predicted specific and immunogenic antigen from the OmcB protein for the serodiagnosis of Chlamydia trachomatis infections

Vector Region Primera Sequencesb Size of DNA fragment (bp) Location of DNA fragment (bp)c
PinPoint Xa-1 Nt F
R
CCCTACGAACAAACTCATCAGAC
AACAAGCTTTTATTCAACATTACGATCA
312 1–312
   U19 GTTTTCCCAGTCACGTTGTA   
  Ct F
R
§CGA GACTGTAAAGAACTGAATCCTG
AATAAGCTTTCAACAGGTACCACAGTCA
120 1131–1251
   T7 TTGTGAGGGGATAACAATTTC   
  S F
R
GTGACGCGGTGCAGGGCG
ATTTAGGTGACACTATAG
  
pGEX-6P-1 Nt F
R
£ACCCGAATTC CCAATGAACAAACTGATAAGAC
#AACGCGGCCGC TTATTCAACATTACGATCA
312 1–312
  Ct F
R
¥AGACGGATCC TGGACTGTGAAAGAACTG
#AATGCGGCCGC TCAACAGGTACCACAGTCA
120 1131–1251
  S F
R
CCAGCAAGTATATAGCATGG
CCGGGAGCTGCATGTGTCAGAGG
  
  1. a: F, forward, R, reverse, S, sequencing primer. b: Listed 5'-3'. The sequences in bold are primers restriction enzymes used for cloning (§ :Nru I, £: Eco RI,#: Not I, ¥:BamH I). c: Locations of DNA fragments are according to Genbank accession number [EMBL: X55903].