Skip to main content

Table 3 Modified primers for Y. pestis from [15] designed for the new multiplexed reactions.

From: Fieldable genotyping of Bacillus anthracis and Yersinia pestis based on 25-loci Multi Locus VNTR Analysis

YP MODIFIED MARKERS PRIMER SEQUENCE
YPms01 F: ACTTCGATGATTATTTTGTGCGTA
R: TGTTTGGTGCTATTGCCGTA
YPms09 F: TTTTTGCCGCACTGAACATA
R: TCTGATGATTGTTGTGGTCGT
YPms15 F: ACAAGCAAGTTGCGCAGATA
R: CAAGTTCGCTTTCTGTGTCG
YPms20 F: GCCAGAATAATGGCCGTAAA
R: GTGGTTGTTCTTCACGTTGC
Ypms21 F: ACCGGCTTAAAGCAGATTGA
R: TTCCCTGTACTCGATTGTTGTG
YPms40 F: TCCTGCTGCTGAGTTCATCTT
R: TCATGTGCAATAGGCGTTGT
YPms56 F: GCTCTAACAACGCCGGTAAA
R: ATGGCATCAACCGACTGACT
YPms62 F: AAACGGTCGTTAACGGAAGA
R: GCTGAACAGCCCCATAAAAC