Skip to main content

Table 2 Loci analyzed by PCR in S. maltophilia strains

From: PCR-based rapid genotyping of Stenotrophomonas maltophiliaisolates

locus coordinates PCR primers Ta
I 0078153–0078502 f [0077906] CACCGCCGAGTGCGATGCCGATCTT 69°C
   r [0078751] ACCCGACCGTGGACATGGACGTGCG  
II 0458218–0458270 f [0458122] GACGTGAAGTGGCTGCGCCTGAAGC 65°C
   r [0458343] CGTTCCAGCCACTGTACCGCCACCA  
III 0898001–0898182 f [0897802] GTGGTGGTGATCAAGCGCGGCAAGG 68°C
   r [0898549] GGCAGGTCGGCTGGATGGCGGTACT  
IV 1260576–1260695 f [1260393] CAGGAACGATGTGCGGGCAGTGACC 66°C
   r [1260806] CTGTCCGAAACACATGGCGTGGCAG  
V 1397805–1398345 f [1397652] TGATCGGCATCATCGTGGTCGGTAC 65°C
   r [1398470] GCGAGTACCTGAGCGAACTGGGGTG  
VI 2363422–2363811 f [2363314] CAGCATCATCAACAAGCACCATGGC 65°C
   r [2363972] TATCGCTTCCTGACCAAACCGTGGA  
VII 2877734–2877879 f [2877624] GCCGCTGGTCTGGCCGTTGATGATG 65°C
   r [2877987] GCTGGAGCTGCACCTGAGCGCCTGG  
VIII 2893713–2894397 f [2893497] TGGACCGCCACCGACTACCTGATGG 67°C
   r [2894486] CACCACCACCACCGAGGTCTACCCG  
IX 3626782–3627370 f [3626652] CGAGTACTTCACCCCGGTCAACGAG 65°C
   r [3627448] AGGGCCAGACCTTCGAGGAATTCAA  
X 3842432–3842620 f [3842338] TGGTGGTCAATGATGGGCAGCCGGA 66°C
   r [3842731] CCGCCACGATGACTGGTCTCAGCCG  
XI 4475729–4476245 f [4475549] CACAGGTCACACAGCGTGGTGTACG 65°C
   r [4476369] GGTTGTTCGGCATCGGTTTGATCAT  
XII 4528877–4529176 f [4528752] CGCCATCCAGCCGTCCTGTACTGCT 66°C
   r [4529342] GGCGGGTTGGGTGGGTACTACCTGG  
  1. The coordinates of the loci on the genome of the K279a strain, the forward (f) and reverse (r) primers in the 5'-3' orientation, their 5' end position, and the annealing temperatures (Ta) are shown.