Skip to main content

Table 1 Primers used for PCR amplification of mce1A and mce4A gene.

From: Characterization of Mce4A protein of Mycobacterium tuberculosis: role in invasion and survival

Primer* Sequence (5' to 3') Gene
mce1F ATCTCACGGTGTGAGCTCATGACGACGCCGG mce1A
mce1R CGACGG TTCCAGAAGCTTTCATGGGTTGAT  
mce4F CTTCAGAAAGAGCTCATGTCCGGCGGCGGA mce4A
mce4R CGCCCGAGCAAGCTTTCAGAAGTCGTCCCG  
  1. * Restriction sites in primers are indicated in bold letters.