Skip to main content

Table 2 Oligo nucleotides.

From: Structural Prediction and Mutational Analysis of the Gifsy-1Xis Protein

Oligonucleotide Sequence Function
Xis-1060f TACCCACGCCGAAACAAG Sequencing of pSM13-1
Xis genemorphf ATTTCACACAGGAAACAGAATTCCCGGGGGA PCR mutagenesis
Xis Genemorphr TCTCATCCGCCAAAACAGAAGCTTGGCTGCAGTTT PCR mutagenesis
pET27bplusXisNde1f GCGCGCGCGCCATATGAGCAAAAAAATTAGAGACTTTGAATTGATG Cloning of Gifsy-1 xis into pET27b+
pET27bplusXisBH1r GCGCGCGCGCGGATCCTCACGCCACGTCAGACCGGATGAGTCGACC Cloning of Gifsy-1 xis into pET27b+
T7 promoter TAATACGACTCACTATAGGG Sequencing of pET27b+ constructs