Skip to main content

Table 2 16S ribosomal gene primers used for PCR amplification or DGGE

From: A short-oligonucleotide microarray that allows improved detection of gastrointestinal tract microbial communities

Primer Sequence (5'-3') Primer target sitea Reference
Amp F GAGAGTTTGATYCTGGCTCAG 0006 [13]
Amp R AAGGAGGTGATCCARCCGCA 1530 [13]
InfL6b TATCGGGGAGCAAGCGAG 0445 [53]
Bif662-r CCACCGTTACACCGGGAA 0662 [3]
ENT183c CGTCGCAAGACCAAAGAG 0183 [54]
424R CCGCTGAAAGTACTTTACAACC 0424 This study
F-968d GAACGCGAAGAACCTTAC 0968 [55]
R-1401 CGGTGTGTAGAAGACCC 1401 [55]
F-341d CCTACGGGAGGCAGCAG 0341 [56]
R-534 ATTACCGCGGCTGCTGG 0534 [56]
  1. aPrimer target site according to E. coli 16S ribosomal gene numbering as the reference.
  2. bThis primer was known as B. longum grp3 for the microarray.
  3. cThis primer was designated Enterobacteriaceae1 for the microarray.
  4. dA 39 nt GC clamp was added to the 5' end of the primer when used for DGGE.