Skip to main content

Advertisement

Table 2 Oligonucleotides used in this study

From: Functional analysis of the group A streptococcal luxS/AI-2 system in metabolism, adaptation to stress and interaction with host cells

Oligo aF/R Sequence 5'-3' bSpecificity
oliRN110 F CGCTGCGTAAAAGATACG aphIII
oliRN111 R AATGGAGTGTCTTCTTCC  
oliRN130 F TTGAAATGACAAAAGAAGTT luxS
oliRN129 R AAAGAGGCTATGATCCTTAT  
OLEC287OLEC288 F AGTTAAGTGACGATAGCCTAG 5S rRNA
  R CTAAGCGACTACCTTATCTCA  
oliRN242 F CGGTAACTAACCAGAAAGGG 16S rRNA
oliRN243 R CGTTGTACCAACCATTGTAGC  
    Virulence genes
OLEC137 F GACCTACTCAGGCAAATC fbp54
OLEC138 R CTTGTCTAAGGCAATCTC  
oliRN204oliRN203 F TGGTAAAAATGCCTATACCC isp2
  R GACCTCGTGAAAACTTAGCC  
oliRN248 F AGGAATAAATTGGTCCTCTT nga
oliRN249 R GGCAGTTTCAATAAACTCAT  
OLEC268 F AAGAGATCGAAGAAAGTCTT scl
OLEC269 R TTTGGTTAGCTTCTTTGTCA  
oliRN202oliRN201 F AGTTAAGGCACAAGAACAGG sibA (psp)
oliRN246 R TACTTGAGGCACTTTGAACC  
oliRN247 F ACTAGGAGCTACACAACCAG sic
oliRN263 R TACCCTGTACCTAATGCTTC  
oliRN264 F ACATCTCAAGAATTACTAGC ska
oliRN279 R TTGTTGTAGAGTAGTTTAGC  
oliRN50 F ATGGAAAATATTCTGATATCTTAG slo
oliRN47 R CCCAAAGGATTTCATATTGAGC  
  F CATAATTACAGTCACTGATT speC
oliRN48 R ATCGAAATGACTAAAGTTCTTCAT  
oliRN55 F TTTTCAATGGTAGCTCTTG speF (mf)
oliRN56 R TTCTTGAGCTCTTTGTTCG  
    Stand-alone regulators
OLEC274 F ATAGCCTAGAAACAGAATTA codY
OLEC275 R TTCTGAATAAGAAAGCGTAT  
oliRN170 F TAAGTAAGTTGTTTACAAGTCAAC AGTGGAG mga
oliRN136 R AAAGGCGTAGATCAATTGG  
OLEC337 F ATGACGCCTAATAAAGAAGA mtsR
OLEC338 R CTGTGACATAAAGTTGCTTA  
OLEC315 F TGGACATTCATTCACATCAG perR (spf)
OLEC316 R ATCAGGTTGGTCTTTTGCTT  
oliRN73 F AAATACTTGGAATCATCAATCG rofA
oliRN74 R TTTTCTTGAGCTAATGCAACCG  
OLEC278 F TAGACAACTTGAATGTCAAT ropB
OLEC279 R AAGCTTTATCATACTCTTGT  
OLEC276 F ACATTTTGCAACGGTATATT srv
OLEC277 R AATAGGGTCATTAAGTCATA  
    Two-component systems
oliRN175 F CTGCTTGACTTAATGTTACC covR (CovRS)
oliRN176 R TTTGACAATAATTCTTCACG  
OLEC182 F GAGCAATAACATTTTAGG fasX (effector molecule, FasBCA)
OLEC183 R TTACAATCAGCTGATGTG  
OLEC270 F ATTCGAAAGACATCAGATGT Irr (Ihk/Irr)
OLEC271 R CATATGTCATCCATCAATTG  
OLEC339 F GATATCATGATGCCGATTAA sptR (SptRS)
OLEC340 R TAGCTAGTATCTTTATCACC  
OLEC280 F TACTTATTGTGGATGATGAA vicR (VicRK)
OLEC281 R AATCATATCCCCAAACAATT  
oliRN23 F AATTGTGAATTC TATCATAATTGTGG (Eco RI) Cassette aphIII for luxS- deficient mutants
oliRN24 R TAAATCAAGCTT CTAAAACAATTCATCCAG (Hin dIII)  
oliRN20 F ACTAGTGAATTC TCAAACATAACAATCC (Eco RI) Fragment luxS down for luxS- deficient mutants
oliRN19 R TTCTGAGGATCC CCACCATCCAGCC (Bam HI)  
oliRN22 F AATCAAGCATGC TTACTTGGAAAAGAACCCAACC (Sph I) Fragment luxS up for luxS- deficient mutants
oliRN21 R AAGTGGAAGCTT GTGGAGGAGAAAAGGC (Hin dIII)  
oliRN267 F CATCGCTGCGCCTCTTGCTAC Confirmation of the luxS- deficient mutants
oliRN268 R GGGTCATTCCAGAACCACAGA  
oliRN70 F GCTATTTTTTGACTTACTGGG  
oliRN69 R TCCGTATCTTTTACGCAGCGG  
oliRN205 F GTCAATGGATCC CCAGCTCTATTGCACC (Bam HI) PluxS-luxS-TT insert for luxS complementation plasmid pEC83
oliRN280 R TATCTAGAGCTC TAGATTACTGAGAAAATC (Sac I)  
oliRN250 R ATTCTTCAGAAATAAGACG Primer extension
  1. a F, forward; R, reverse. Underlined sequences indicate restriction sites.
  2. b fbp54 (fibronectin-binding protein), isp2 (immunogenic secreted protein homologue), nga (NAD-glycohydrolase), scl (streptococcal collagen-like protein), sibA (secreted immunoglobulin binding protein), sic (streptococcal inhibitor of complement), ska (streptokinase), slo (streptolysin O), speC (streptococcal pyrogenic exotoxin C), speF (mf) (mitogenic factor).