Skip to main content

Advertisement

Table 2 Oligonucleotide primers

From: Demonstration of IS711 transposition in Brucella ovis and Brucella pinnipedialis

Primer name Sequence 5'-3' Reference
711u CACAAGACTGCGTTGCCGACAGA This study
711d CATATGATGGGACCAAACACCTAGGG This study
G11 TATCAGCTATGCGCCGACCAGAAC [20]
G12 GCCAATCCCCATGGCATCGAGTAA [20]
REPTC1 GGCGTTATAAGCATTTAATG This study
REPTC2 AAAAAGAAACCATTAACACA This study
ISOUT1 GCGGCCGGGCGTACCAACTCG This study
ISOUT2 GCTATCGTCGTATTGCGCTGC This study