Skip to main content

Table 3 Oligonucleotide primers and probes used in real-time multiplex PCR assay.

From: Development of a real-time multiplex PCR assay for the detection of multiple Salmonella serotypes in chicken samples

Target gene Primer or Probe Sequence (5'-3') Tm (°C) Amplicon Size (bp) Reference or Accession No.
sefA Forward GTGGTTCAGGCAGCAGTTACT 61.1 334 L11008
  Reverse CAGGGACATTTAGCGTTTCTTGAG 59.7   
  Probe ROX-CAGCTCAGAATACAACATCAGCCAACTGG-BBQ 66.2   
fliC Forward CCCCGCTTACAGGTGGACTAC 60.2 433 AY649721
  Reverse AGCGGGTTTTCGGTGGTTGT 63.6   
  Probe YAK-TAAAGCCGCATTGACAGCAGCAGGTG-BBQ 69.8   
aceK Forward CCGCGCTGGTTGAGTGG 62.0 240 U43344
  Reverse GCGGGGCGAATTTGTCTTTA 60.3   
  Probe FAM-AACCACTGCCGAACTGTATATGGCGA-BBQ 65.0   
sdf Forward AAATGTGTTTTATCTGATGCAAGAGG 57.6 299 [35]
  Reverse GTTCGTTCTTCTGGTACTTACGATGAC 58.7   
  Probe Cy5-CGAATGGTGAGCAGACAACAGGCTGATTTA-BBQ 68.4   This study