Skip to main content

Table 2 VNTR loci on the genome of S. Enteritidis

From: Allele distribution and genetic diversity of VNTR loci in Salmonella entericaserotype Enteritidis isolates from different sources

Locus (alias) Dye labeled Primer sequences (5'-3') PCR set Conc. (uM) Location (size)b; gene Repeats size (bp) No. repeatsc Reference
SE1 D3 F – AGACGTGGCAAGGAACAGTAG    LK5 Contig 1680_10.15    
   R – CCAGCCATCCATACCAAGAC A 0.10 283–549 (267 bp) 7 5 [15]
SE3 D2 F – CAACAAAACAACAGCAGCAT    LK5 Contig 1921_10.15    
   R – GGGAAACGGTAATCAGAAAGT A 0.10 537–856 (320 bp) 12 4 [15]
SE8 D2 F – TTGCCGCATAGCAGCAGAAGT    PT4    
   R – GCCTGAACACGCTTTTTAATAGGCT A 0.15 2812703–2813171 (469 bp) 87 1 [15]
SE10a(STTR1) D4 F – GCTGAAGAAGCGGCAAAAC    PT4    
   R – GTACCGCTATCTTTCGATGGC A 0.05 774231–774760 (530 bp); SEN0697 45 8 [15, 27]
SE2 D4 F – CTTCGGATTATACCTGGATTG    LK5 Contig 1930_10.15    
   R – TGGACGGAGGCGATAG B 0.05 906–1106 (201 bp) 7 5 [15]
SE5 (STTR5, Sal16) D2 F – CGGGAAACCACCATCAC    PT4    
   R – CAGGCCGAACAGCAGGAT B 0.10 3073216–3073427 (212 bp); SEN2867 6 12 [15, 27, 28]
SE6a(STTR3, 3629542) D3 F – CGGTGGCGGAGATTCTAATCA    PT4    
   R – ACGCCGTTGCTGAAGGTAAT B 0.10 3510975–3511412 (438 bp); SEN3305 33 11 [15, 27, 29]
SE7 D4 F – CCGACCCAATAAGGAG    LK5 Contig 1168_10.15    
   R – CTTACCGTTGGTAGTTTGTTA B 0.03 323–867 (545 bp) 61 8 [13, 15]
SE9 D2 F – CGTAGCCAATCAGATTCATCCCGCG    PT4    
   R – TTTGAAACGGGGTGTGGCGCTG B 0.10 533132–533460 (329 bp); SEN0475 9 3 [15]
  1. a: Primer sets were redesigned in this study to remove non-specific PCR amplicons when multiplex PCR is applied.
  2. Repeats sequences for locus SE6: TCGTCATCGCCGCTATCGTCGGGCGGGGTTACA
  3. Repeats sequences for locus SE10: TTCGGCATCCGCTTTCTTCTTCGCGTCCGCCGCCGCTTTCGCCGC
  4. b: The locations were based on the genome sequences of Salmonella enterica serovar Enteritidis LK5 http://www.salmonella.org/genomics/sen.dbs and PT4 http://xbase.bham.ac.uk/colibase strains
  5. c: Alignment parameters chosen to weight for match, mismatch and indels were 2.3.5 or 2.5.5 which is more permissive than other options http://tandem.bu.edu/trf/trf.html. Repeat numbers for locus SE7 were counted manually due to imperfect repeat sequences. Repeat numbers for all loci are rounded to the nearest integer. For example, repeat number at locus SE7 in LK5 strain was rounded from 7.5 to 8.
\