Skip to main content

Table 1 Sequences of primers used in kinetic PCR reactions.

From: Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms

SNP Primer Name Primer Sequence (5' – 3')
glnA36 glnA36-C ATATCCTGATTTAGATACTTGGATTCTC
  glnA36-T ATATCCTGATTTAGATACTTGGATTCTT
  glnA36-Rev TCTCCTTCTGCTGTATAGATATCACA
glnA4291 glnA429-G1 TTGTTTTAACAACCAATTTAAATAATTGAATC
  glnA429-A TTGTTTTAACAACCAATTTAAATAATTGAATT
  glnA429-For AAGTAGCAGTTGGACAGGATGAAA
glcK180 glcK180-A GGCTGATACTCAAGAAGTAGGTTAA
  glcK180-G GGCTGATACTCAAGAAGTAGGTTAG
  glcK180-Rev ACCAAGTGCTGCAACATTAGC
adhP111 adhP111-G TTGCATGGTTCTTTGAATGG
  adhP111-A TTGCATGGTTCTTTGAATGA
  adhP111-T TTGCATGGTTCTTTGAATGT
  adhP111-Rev CAAAGCGTCTCACGTCCTGT
atr351 atr351-A GTTGTTGTTGTCCTCCAGATAAGCTA
  atr351-T GTTGTTGTTGTCCTCCAGATAAGCTT
  atr351-Rev GGACTCAAAGAGAAGGCTAATGCT
  1. The allele specific primers are named in accordance with their specificities, while the common primers are names in accordance with their orientation with respect to the coding DNA sequences.
  2. 1The glnA429 allele specific primers are in the reverse direction, hence the inconsistency between the alleles and the 3' terminal nucleotides.