Skip to main content

Table 2 Primers used

From: Inducible Siphoviruses in superficial and deep tissue isolates of Propionibacterium acnes

Name Sequence (5'-3') Reference
PR264 GCAGGCAGAGTTTGACATCC [38]
PAR-2 GCTTCCTCATACCACTGGTCATC [39]
MHF TCCTGGTTCTATGATTGGTGCG This study
MHR CGGAGACCCCTTCGGATACAC This study
MH1F CGTTTGTGGATGCTCTTGTCA This study
MH1R CCTTCGGATACACCTCAGTAGACA This study
MH2F GCTCTTGGTGCTTCGATTGGT This study
MH2R GATACCCATCAACACCACCCC This study
Ami1F GGTTTGAATGGTGTGAAAGGTC This study
Ami1R TTTCGGAACATTATATTTGTCACAC This study
Ami2F TATCGAGATTTGCGCGGAT This study
Ami2R ACCACGAAACGACTCCGC This study