Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Details of Lxc-IS elements.

From: Characterization of new IS elements and studies of their dispersion in two subspecies of Leifsonia xyli

Lxc-IS IS length (bp) Tpase length (aa)a IRs DR (host sequence) Minimal no of copies IS familyb Most related Lxx-IS
IS1237 899/798 218 5' GAGGTGGTTTCAGTAGTCG
3' GAGATGGTTTCAGTAGTCGc
TTA (TAA) 26 IS5 ISLxx6
ISLxc1 2631 262 (istB) 5' TGTCTGTGTCACTGTTAGCGGGCTCCG GGTTGTCGGAGTTGTCTGGCCCCGGCG
3' TGACTATGTCAAGGCTGGCGGGGACCG GGTTGTCGAAGTTAGTTGGCCCCAGCG
fATCGCC 2 IS21 ISLxx3
ISLxc2 1105 332 5' TGTGTTTCTCAGGGACGTTGGT
3' TGTGCTGCTCAGGGACGTTGGT
NCTAGN 16 IS481 ISLxx4
ISLxc3 1511 351 5' CTTGGGTTCTAACGGTCGTTGCAACA
3' GGCGGATTCTAGTGGTCGTTGCAACA
- 8 IS30 ISLxx5
ISLxc4 1311/896 380 5' GGGTGGGTTCTAACAGTGGTCGCAACAC
3' GGGTGGGTTCTAACAGTGGTCGCAACAC
- 5 IS30 ISLxx5
  1. N – not complementary nucleotides
  2. a – assuming predicted features for regulation of transposition at translational level are overcome.
  3. b – according to Chandler & Mahillon family classification [11].
  4. c – three IS1237 copies have a G instead of A in the 3' IR, making perfectly complementary IRs.