Skip to main content

Advertisement

Table 3 Oligonucleotide primers used in the present study

From: Identification of the genetic determinants of Salmonella enterica serotype Typhimurium that may regulate the expression of the type 1 fimbriae in response to solid agar and static broth culture conditions

Primer Sequence (5'-3')
kan-5 TAACATCATTGGCAACGCTACCT
kan-6 GCATCGGGCTTCCCATACAATCG
kan-7 GTCGCACCTGATTGCCCGACATT
cafA-F ATACGACTCACAACCTTGCTTTGCCGGACG
cafA-R TTTCTGCGCAGGATATTAGTGGCTATGTCG
res-F CATTGTCATTTACGGCTACTCT
res-R ACGATAACCTTCAAGTCAAC
miaA-F CTGCTGGCGGATGTTGAGCGGCTATGT
miaA-R CGCAATGCGTTCAGGAACGGATCTTGT
nusA-F CCGTCCTATGTTCACTGCCGAT
nusA-R CTGCTGTACCAGGCGATCCACGGAAAC
ubiB-F GGTCGTCCTATTGTTAAAGATCCTGA
ubiB-R CGCAATACAAAGCCTGTAGATATTCA
16S-F TTCCTCCAGATCTCTCTACGCA
16S-R GTGGCTAATACCGCATAACG
fimA-F ACTATTGCGAGTCTGATGTTTG
fimA-R CGTATTTCATGATAAAGGTGGC