Skip to main content

Table 2 Primers used in this study

From: Molecular analysis of the emergence of pandemic Vibrio parahaemolyticus

Primer Designation Primer sequence 5' – 3' Ta (°C) Product size (bp)
VPaI-2    
VP0634F GGGGGAAATAAATGTCTGAAGG 52.1 1363
VP0634R AACACGCCAAGACTCTC   
VP0637F GGAATAACTCAGAGCTTCG 52.8 1848
VP0640R TAGGCAGTCGTAATTCG   
VP0643F ATACGCCTGATTGCTTC 52.0 1558
VP0643R TGGTACTATCAACGCCG   
VP0644F CGTGCTTTTTCTCTTGC 51.1 970
VP0644R CCATATTGCTAGTTAGCTCG   
VPaI-3    
VP1069F TAGGGTCGGTGGTGTACTTG 52.8 2041
VP1069R GACTCCACTATTGGTTTA GC   
VP1072F AGAGTCAGAGGAAAGGGAGG 50.3 2275
VP1073R GTAAATGTTGTGGGTGC   
VP1079F CTGTCTTCATGCCTTTG 51.0 1691
VP1079R CGCCATTGCTAAACGTC   
VP1083F CTTACTTATTGGAGGCTGG 52.1 2127
VP1083R GGTGGGTATAAAGGTAACG   
VP1095F TCTGGTTCGGTATTTGG 52.7 1166
VP1096R CGCAGCATTTCTTGAAG   
VPaI-7    
VPA1308F TTAGAACGCATGAGCACCG 53.1 1844
VPA1309R CCACCAAAGTGTTTGTGAG   
VPA1312F CTACTATCATCACGACGTG 49.4 1487
VPA1314R CGTGCTTATAGCCAGAC   
VPA1317F GACAGACAGAGATACGCTG 50.9 1366
VPA1320R TTCAGAGGTGTCGCACTTCG   
VPA1321F CGTGGTGGTTAGTGAATC 49.1 886
VPA1321R AGAGTTGGTTTCGCAGG   
VPA1321F GACCACTATATTGTTCTCCG 49.4 1480
VPA1323R CTCAGGGATAAATAGGGATG   
VPA1331F CCAATAATCACCCTCCG 49.9 1857
VPA1334R CTCAGGGATAAATAGGGATG   
VPA1340F GTCCTTGATTACACCATTGG 51.8 1618
VPA1343R GCACGTAACATCTAAGTTCGTG   
VPA1350F TGCATCGTCATTTCTCC 50.4 2630
VPA1354R CGTAGATTTCATGGCAG   
VPA1363F TTTCACTAATGCTGCGG 51.1 2308
VPA1365R GGTCAATATGGCACTATGC   
VPA1380F TTAGGGGTGTTATGCCG 48.5 816
VPA1380R TTACTGTCTCTGTTGCAGG   
VPA1390F CCACAACACAAACTGTCC 50.9 2606
VPA1393R AATCCAAGGGGAGTGAC   
VPA1394F AACGCCGAATTAACCGC 53.2 2356
VPA1395R TCACCCCAATGTACCGTCTG   
VPA1397F GCGGAGCTGTAATGAAATG 52.9 793
VPA1398R CAACCAACGTATTGTAGCAG   
VPA1400F ATAGGTCTGTGTAACCCG 52.3 1964
VPA1401R GGTAAAGCTGCGATGAC   
VP0085F TGCTCGCTGCTATCTAC 53.0 1160
VP0085R CGTTAAATACGCCAGTTGC   
VP0220F CCCTCAAGTGATTGATCC 53.0 1878
VP0220R AAGATAGCCCCTTGTGG   
VP1399F CATCTCTTGCTCTTGGAG 51.0 1312
VP1400R TGAGGTCTACAATGAGTCAG   
VP1415F CGCAATTAAAGGCAGTACG 51.0 2274
VP1416R GACTGAATAAGAGTGCTCG   
VP1556F TCCCGATTGTAAGTTGC 53.0 1957
VP1558R AGCTAATGCGAATGAGC   
VPA0446F ACGTTCTTTTGGGATGG 53.0 2376
VPA0447R ACCGAAGCCTTAACACG   
VPA0450F AATGCGAAAGAAGGCGATAC 60.0 1337
VPA0450R TGCGCTTGTAGATGAGTTGG   
VPA0891F GTCGCTCTTTATGTTGC 50.5 615
VPA0891R GAAGCCTGTATCAACTGTC   
VPA0894F TAATGGTCGATGCACTG 54.0 1215
VPA0894R GGATGAGCAAGTCAGTAGC   
VPA0952F CGAGTGATCCAGTTTTACAC 52.0 2720
VPA0953R AACTACCAGCTAGAAGTGG   
VPA0992F CCGACATAAAGGGATACTC 52.0 1926
VPA0992R GAAGAAGCACTTGCTCTC   
VPA1443F CAATCAGCAGCCAGTCGTTA 60.0 1233
VPA1443R CCGGATGTCAAACGGTACTT   
VPA1503F GTTCGACAATGGCATGTGAG 60.0 801
VPA1503R CGCCAGTATCGACATCACTC   
VPA1655F CCGTTTTGCTGATGCTACTG 60.0 816
VPA1655R ATGACCACAGTTCCGGAGAG   
VPGyrBF GTA CTG AAG GGT CTG GAT GC 54.6 742
VPGyrBR ACT GCA TTG CCA CTT CTA CC   
VPmdhF TGAAAGTAGCCGTTATTGG 54.0 901
VPmdhR CCATTTAGCGTTTCTAGCATTC   
VPGroEL1F TTTCGGTGCTCCAACCATC 55.4 737
VPGroEL1R GCATTGCTTTACGACGGTC