Skip to main content

Table 2 Oligonucleotides used in this study. For oligonucleotides used in PCR the amplicon size is listed, and for those oligonucleotides used solely for DNA sequencing no product size is listed

From: Limited genetic diversity in Salmonella enterica Serovar Enteritidis PT13

Oligonucleotide Target Sequence (5' to 3') Product size (bp) Reference
sfimAF fimA TCAGGGGAGAAACAGAAAACTAAT 760 [25]
sfimAR   TCCCCGATAGCCTCTTCC   [25]
smanBF manB CATAACCCGATGGACTACAACG 893 [25]
smanBR   ACCAGCAGCCACGGGATCAT   [25]
smdhF mdh GATGAAAGTCGCAGTCCTCG 849 [25]
smdhR   TATCCAGCATAGCGTCCAGC   [25]
ccmBF ccmB TCACCCTGTTTCCGTTAAGC 430 This study
ccmBR   AAAATCAGCACCGGGACAC   This study
umuCF umuC TGACCACACTCGAGGAGATG 493 This study
umuCR   CAAACGATTTCCTGCTTTGC   This study
fljAF fljA GGCGAGAAGCTGAAATATGG 410 This study
fljAR   ATTTACGCCTGTCGTTTTGC   This study
safA2F safA TAAGAGGTGCTCTGATATATAG 959 This study
safA2R   ATAGGGTAATTCTGCGGGTTG   This study
caiC1F caiC GAATCGTTCGGCAGTTTAGC 874 This study
caiC1R   GTTTCAGTCATACCATAAGAGG   This study
citT1F citT GATGATTGTCGGTATGATCC 870 This study
citT1R   GTAATATCTTTCCACGGCAC   This study
dmsA1F dmsA ACTACGGTGATTACTCTTCC 869 This study
dmsA1R   CTGGTTAATCAAACAGTTGC   This study
ratA1F ratA GGCAAGATTCACAGCATTCAG 870 This study
ratA1R   TGGGCGGTATTTATCGTTCG   This study
STM0660F STM0660 ACGATGTAGCCCATATTACG 1191 This study
STM0660R   CCTGGCGAAAGTATTCATCC   This study
spvC1 spvC AACTCCTTGCACAACCAAATG 230 This Study
spvC2   ACCATATCCCTGAGCACACTG   This Study
Cya1sF cyaA CATTGACCATCCTAACATCCTTATAGAGAG 3331 [31]
Cya6sR   ACTGGCGATATCACTCAATAGCGG   [31]
Cya1sR cyaA ATGCTGCGTAGAACCACAGTCTTC   [31]
Cya2sF cyaA TGGATATCTGGGTGTGCCATCAGT   [31]
Cya2sR cyaA GACTTTACCCGGCAACGCTTCAAA   [31]
Cya3sF cyaA CGATTACCGGCGTTTACACCAT   [31]
Cya3sR cyaA ATATCTTTCGCCAGCAGACGTG   [31]
Cya4sF cyaA CGCAGGATATCGGCGTACTGA   [31]
Cya4sR cyaA GACGGCAATTTCACCTGGTGGTT   [31]
Cya5sF cyaA GCGTCGGGAAGTATTAAGCCAGTT   [31]
Cya5sR cyaA AGGTCGACAATACCGTTGCCCTTA   [31]
Cya6sF cyaA TACGTCTTCCAGCACCCGTCA   [31]