Skip to main content

Table 1 List of probes used in this study

From: Identification of human pathogens isolated from blood using microarray hybridisation and signal pattern recognition

Specificity Name E. coli Pos. Sequence [5' – 3'] Length bases Tm°C GC % Ref.
Ab. baumannii aba1 64 CAAGCTACCTTCCCCCGCT 19 60.3 63 this
  aba2 453 GTAACGTCCACTATCTCTAGGTATTAACTAAAGTAG 36 59.1 36 work
  aba4 1132 GCAGTATCCTTAAAGTTCCCATCCGAAAT 29 60.8 41 "
Ab. johnsonii ajo2 620 TCCCAGTATCGAATGCAATTCCTAAGTT 28 60.1 39 "
  ajo3 979 GAAAGTTCTTACTATGTCAAGACCAGGTAAG 31 58.8 39 "
  ajo4 1114 CTTAACCCGCTGGCAAATAAGGAAAA 26 60 42 "
Ab. lwoffii alw1 133 GAGATGTTGTCCCCCACTAATAGGC 25 60.4 52 "
  alw2 577 TGACTTAATTGGCCACCTACGCG 23 61 52 "
  alw3 637 CCCATACTCTAGCCAACCAGTATCG 25 59.9 52 "
Ab. ara1 78 CGCTGAATCCAGTAGCAAGCTAC 23 59.1 52 "
radioresistens ara2 450 GTCCACTATCCTAAAGTATTAATCTAGGTAGCCT 34 60.3 38 "
  ara3 1115 CCGAAGTGCTGGCAAATAAGGAAA 24 59.8 46 "
Cb. freundii cif1 62 GCTCCTCTGCTACCGTTCG 19 58.2 63 "
  cif2 442 CCACAACGCCTTCCTCCTCG 20 61.1 65 "
  cif3 472 TCTGCGAGTAACGTCAATCGCTG 23 60.7 52 "
Cb. koseri cik1 469 CGGGTAACGTCAATTGCTGTGG 22 59.9 55 "
  cik2 639 CGAGACTCAAGCCTGCCAGTAT 22 60 55 "
Eb. cloacae ecl4 471 GCGGGTAACGTCAATTGCTGC 21 60.6 57 "
  ecl6 643 CTACAAGACTCCAGCCTGCCA 21 60 57 "
  ecl7 652 TACCCCCCTCTACAAGACTCCA 22 60 55 "
Eb. aerogenes ena2 444 GGTTATTAACCTTAACGCCTTCCTCCT 27 60.2 44 "
  ena3 453 CAATCGCCAAGGTTATTAACCTTAACGC 28 60.4 43 "
  ena4 473 TCTGCGAGTAACGTCAATCGCC 22 60.8 55 "
K. pneumoniae kpn1 61 GCTCTCTGTGCTACCGCTCG 20 60.7 65 "
  kpn2 203 GCATGAGGCCCGAAGGTC 18 58.9 67 "
K. oxytoca klo1 81 TCGTCACCCGAGAGCAAGC 19 60.5 63 "
  klo2 633 CCAGCCTGCCAGTTTCGAATG 21 60 57 "
E. coli eco2 448 GTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCC 40 61.9 40 31
  eco3 994 CCGAAGGCACATTCTCATCTCTGAAAACTTCCGTGGATG 39 65.6 49 31
M. morganii mom2 121 GCCATCAGGCAGATCCCCATAC 22 60.9 59 this
  mom3 440 CTTGACACCTTCCTCCCGACT 21 59.7 57 work
  mom4 581 CATCTGACTCAATCAACCGCCTG 23 59.4 52 "
P. mirabilis pmi3 247 GTCAGCCTTTACCCCACCTACTAG 24 59.8 54 "
  pmi4 444 GGGTATTAACCTTATCACCTTCCTCCC 27 60 48 "
  pmi5 625 CCAACCAGTTTCAGATGCAATTCCC 25 60.4 48 "
  pmi6 820 GTTCAAGACCACAACCTCTAAATCGAC 27 59.3 44 "
P. vulgaris pvu2 179 CTGCTTTGGTCCGTAGACGTCA 22 60.3 55 "
  pvu4 1010 TTCCCGAAGGCACTCCTCTATCTCTA 26 61.9 50 "
Pm. aerogenes psa4 585 GATTTCACATCCAACTTGCTGAACCA 26 59.9 42 "
  psa5 1136 TCTCCTTAGAGTGCCCACCCG 21 61.7 62 "
  psa6 1245 CGTGGTAACCGTCCCCCTTG 20 61 65 "
Sr. marcescens sem1 62 CTCCCCTGTGCTACCGCTC 19 60.4 68 "
  sem2 439 CACCACCTTCCTCCTCGCTG 20 60.7 65 "
  sem3 460 GAGTAACGTCAATTGATGAGCGTATTAAGC 30 59.8 40 "
Sm. maltophilia sma1 713 AGCTGCCTTCGCCATGGATGTTC 23 63.7 57 "
  sma3 1265 TGGGATTGGCTTACCGTCGC 20 61 60 "
S. pneumoniae spn1 56 CTCCTCCTTCAGCGTTCTACTTGC 24 60.7 54 "
  spn3 201 GGTCCATCTGGTAGTGATGCAAGTG 25 60.9 52 "
  spn5 634 TCTTGCACTCAAGTTAAACAGTTTCCAAAG 30 60.1 37 "
S. pyogenes spy1 175 ATTACTAACATGCGTTAGTCTCTCTTATGCG 31 60.2 39 "
  spy2 471 CTGGTTAGTTACCGTCACTTGGTGG 25 60.8 52 "
  spy3 623 TTCTCCAGTTTCCAAAGCGTACATTG 26 59.6 42 "
Ec. faecium efa1 67 CAAGCTCCGGTGGAAAAAGAAGC 23 60.3 52 "
  efa2 208 CATCCATCAGCGACACCCGA 20 60.4 60 "
  efa3 1240 ACTTCGCAACTCGTTGTACTTCCC 24 60.8 50 "
  efa42 446 CCGTCAAGGGATGAACAGTTACTCTCATCCTTGTTCTTC 39 66.8 46 31
  efa43 1242 ATTAGCTTAGCCTCGCGACTTCGCAACTCGTTGTACTTC 39 69.3 49 31
  efa51 65 CTCCGGTGGAAAAAGAAGCGT 21 59 52 this
  efa52 82 CTCCCGGTGGAGCAAG 16 57 52 work
Staphylococcus sta1 995 CTCTATCTCTAGAGCGGTCAAAGGAT 26 59 46 "
  sta2 1137 CAGTCAACCTAGAGTGCCCAACT 23 60 52 "
  sta3 1237 AGCTGCCCTTTGTATTGTCCATT 23 59 44 "
  sta4 1264 ATGGGATTTGCATGACCTCGCG 22 62 55 "
Sta. aureus sar1 186 CCGTCTTTCACTTTTGAACCATGC 24 59 46 "
  sar2 230 AGCTAATGCAGCGCGGATC 19 59 58 "
  sar3 447 TGCACAGTTACTTACACATATGTTCTT 27 57 33 "
Sta. epidermidis sep1 1005 AAGGGGAAAACTCTATCTCTAGAGGG 26 59 46 "
  sep2 983 GGGTCAGAGGATGTCAAGATTTGG 24 59 50 "
  sep3 993 ATCTCTAGAGGGGTCAGAGGATGT 24 60 50 "
Ec. faecalis efc1 84 CCACTCCTCTTTCCAATTGAGTGCA 24 61 50 "
  efc2 176 GCCATGCGGCATAAACTGTTATGC 24 61 50 "
  efc3 193 CCCGAAAGCGCCTTTCACTCTT 22 62 55 "
  efc4 452 GGACGTTCAGTTACTAACGTCCTTG 25 59 48 "
C. albicans cal1 - CCAGCGAGTATAAGCCTTGGCC 22 61.2 59 62
C. parapsilosis cpa1 - TAGCCTTTTTGGCGAACCAGG 21 60.6 52 62
  1. List of probes used in this study including their nucleotide sequences and some characteristics. Abbreviations: Ab: Acinetobacter, Cb: Citrobacter, Eb: Enterobacter, Ec: Enterococcus, E: Escherichia, K: Klebsiella, M: Morganella, P: Proteus, Pm: Pseudomonas, Sr: Serratia, Sm: Stenotrophomonas, S: Streptococcus, Sta: Staphylococcus, C: Candida