Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Variability in SCC mecN1 spreading among injection drug users in Zurich, Switzerland

Primer name Nucleotide sequence (5'-3') Reference
Mapping and sequencing
   1 CATACACCAAGATAGACATC This study
   2 ACAACGCAGTAACTATGCAC This study
   3 GTTTATCTTCATAGACTAAC This study
   4 TTCGATGTACAATGACAGTC IS431R, this study
   5 AAGGATGTTATCACTGTAGC IS431F, this study
   6 ATGTCCCAAGCTCCATTTTG HVR P1 F [42]
   7 ACGTGTTAAGTATATTGCAC This study
   8 AAGTAGTAGCTCAACGAGCT This study
   9 CAGACAATCACATCTAACAC This study
   10 TGTTGATTGACAGTAAGGAC This study
   11 GAGTACTATAGCGTATGATGT fusR, this study
   12 ACAAACGATATGAATTCCCA fusF, this study
   13 GTTTATCTTCATAGACTAAC This study
   14 CTAATATGTTGGCGCTGATAT This study
   15 CTACACTACTATTCTTTCAC This study
   16 ATAATTACGACAATGACTGT This study
   17 CGACAATAGGATCTAAAGAT This study
Gene detection
   18 TCCAGATTACAACTTCACCAGG MECAP4 [20]
   19 CCACTTCATATCTTGTAACG MECAP7 [20]
   20 AATAGACGTAACGTCGTACT dfrAF, this study
   21 AAGAATGTATGCGGTATAGT dfrAR, this study
Cloning
   22 ATTAGGATCC CTAGCTGATTTAATCGTTGAAG This study
   23 ATTATCTAGA TAGTAAGATATAATGTTTGGG This study
   24 ATTAGGATCC GATTGATAGTATTGCAATCA This study
   25 ATTAGGATCC GTATAGGAGTGAATGAAATGG This study
   26 ATTAGGATCC ATTGTGCTTGCACAATCCTT This study
ccrAB4-1/-2 CHE482
   27 CAAATGATTGAAACAGAGGT This study
   28 CACGTTTTCTACAATAACGT This study