Skip to main content

Table 2 Primers used

From: Characterization of a small PlcR-regulated gene co-expressed with cereolysin O

Primer name 5'-3' sequence* Restriction sites
Ppep1-L GATACTGCAG CCTTATGGGCCAATAGCAGT Pst I
Ppep1-R CGTCGGATCC TGATTGATAAATGATTGCTAACTAA Bam HI
Ppep2-L CGCAAGCTT TCTAAACAAGGAATCCTACAAAG Hin dIII
Ppep2-R CGCGGATCC CTCCTCTTTTTCGTATTAAGATG Bam HI
Ppep3-L CGCAAGCTT GGAAATAGTGGGTCTAGAACAT Hin dIII
Ppep3-R CGCGGATCC CCTCTTTTGTTAATACTGGGA Bam HI
Extsnclo CTAACTAATAAACATGCAAGGAAC  
  1. * Restriction enzyme sites are underlined.