Skip to main content

Table 1 Oligonucleotides

From: The Mycobacterium marinum mel2 locus displays similarity to bacterial bioluminescence systems and plays a role in defense against reactive oxygen and nitrogen species

Namea Targetb Sequence (5' -> 3')
MelFuF melFu CAGAAGACGCGATCACGGCG
MelFuR   GGGTCGGCGAACACTTCACC
MelFdF melFd CCTGCTGCCCTATCATCACC
MelFdR   CCTCCAAAGCCCGAAGCCGC
MelFtnF melF tn CAGAAGACGCGATCACGGCG
MelFtnR   CCTGCTGCCCTATCATCACC
MelGF melG GCGAGAAGGGCACCGCCATG
MelGR   CTCAGATCACCCACGGTCAC
MelHF melH GTGACCGTGGGTGATCTGAG
MelHR   GAAGGCGCAACTCACTGCCG
MelIF melI CGGCAGTGAGTTGCGCCTTC
MelIR   CATCCAGGCTCCGTTGCGGG
MelJF melJ CCCGCAACGGAGCCTGGATG
MelJR   GCCGCGAGTGGCGTGTCTGC
MelKF melK GCAGACACGCCACTCGCGGC
MelKR   GACGCTCACCACAGTGCGGC
rRNAF rRNA AGAGTTTGATCCTGGCTCAG
rRNAR   CACGCTCACAGTTAAGCTGT
  1. aDesignation for each oligonucleotide used in this study for RT-PCR analyses. F indicates a forward primer and R indicates a reverse primer.
  2. bTarget gene mRNA transcript for RT-PCR analyses. Oligonucleotides are listed as primer pairs. The reverse primers were used for cDNA synthesis and the forward and reverse used together for RT-PCR. The melFu target is the region of the mel2 locus transcript upstream of the transposon insertion in the melF mutant but down stream of the start codon, melFd target is the region downstream of the transposon insertion but still within melF and melFtn is across the transposon insertion in melF.