Skip to main content

Table 4 Oligonucleotides primers related to new genes selected for sqRT-PCR analysis.

From: The transcriptome analysis of early morphogenesis in Paracoccidioides brasiliensis mycelium reveals novel and induced genes potentially associated to the dimorphic process

Sequence name Forward primer (5' → 3') Reverse primer (5' → 3')
DEAD-like helicases superfamily protein (dead) GGCCTTCTGAAACGGGGG GAGCTTCGCAATAGGCCAAG
Hemolysin like protein (hlp) GGCCTTCTGAAACGGGGG GAGCTTCGCAATAGGCCAAG
UVSB Phosphatidylinosytol-3-kinase (uvsB) CTAGCGAATGGCAATATCACT GATAATGAGGGCATGGTCTC
Chitinase 3 (cts3) GGAGGAGGATATGTCTCTTG CTGCTGCCCATCCCTCAG
Alpha 1,2 galactosyltransferase (gma12) GCTATGTCAACTTCTTCGCG GAGAGCATGGGCCGACAG
UDP-N-Acetylglucosamine transporter (mnn2) GCCCTCATTACGTTAACGCA CATGGATTTTCCTTTGGCACT
Guanosine diphosphatase (gdpase) GATCTTCCGCTTTCTCGCCA CTCCTTGACACGGCACTGC
Suppressor of anucleate metulae B protein (samB) CCAGTGCGCCTACTATAAATG CAGGCATTCTTCTGGCACTC
Diphitine synthase (dphs) CTGTTTCGCAGTGTGCCAG CGTTCCGTAATTGCTTTTCCA
Phosphatidylserine synthase (pss) GCTGCTCTCGGCGGACTC CGAAGGAGACCAGATCAGC
Alpha glucosidase I (glcaseI) CCAGCTGATAGTCCACGGC CTTGTCCATCCTGTGAAATGC
Histidine protein kinase sensor for GlnG regulator (glnL) CGTCTGTTGGGGCCGCAG CATCGGGTAAAACAGCGTATC